Incidental Mutation 'R5281:Btn2a2'
ID402796
Institutional Source Beutler Lab
Gene Symbol Btn2a2
Ensembl Gene ENSMUSG00000053216
Gene Namebutyrophilin, subfamily 2, member A2
Synonyms
MMRRC Submission 042866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5281 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23477676-23488857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23478832 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 316 (V316A)
Ref Sequence ENSEMBL: ENSMUSP00000048251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041541] [ENSMUST00000110432] [ENSMUST00000110433] [ENSMUST00000223877]
Predicted Effect probably damaging
Transcript: ENSMUST00000041541
AA Change: V316A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048251
Gene: ENSMUSG00000053216
AA Change: V316A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 3.3e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110432
AA Change: V316A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106062
Gene: ENSMUSG00000053216
AA Change: V316A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Blast:IG_like 151 211 1e-29 BLAST
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110433
AA Change: V316A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106063
Gene: ENSMUSG00000053216
AA Change: V316A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 1.2e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000223877
AA Change: V307A

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. This gene is a member of the BTN2 subfamily of genes, which encode proteins belonging to the butyrophilin protein family. The gene is located in a cluster on chromosome 6, consisting of seven genes belonging to the expanding B7/butyrophilin-like group, a subset of the immunoglobulin gene superfamily. The encoded protein is a type I receptor glycoprotein involved in lipid, fatty-acid and sterol metabolism. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,528,934 H535R probably damaging Het
Aff4 A G 11: 53,372,288 E45G probably damaging Het
Ano10 A G 9: 122,261,486 S254P probably damaging Het
Arhgap21 T A 2: 20,849,316 E1745V probably damaging Het
Atp10b T C 11: 43,254,336 L1302P probably damaging Het
C2cd4c G A 10: 79,613,044 P90S probably benign Het
Cant1 A T 11: 118,408,870 W255R probably damaging Het
Cenpe A C 3: 135,230,150 K449Q possibly damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Dmbt1 T C 7: 131,082,619 V615A probably damaging Het
Dnajc5b T C 3: 19,610,560 V174A probably benign Het
Dst C A 1: 34,257,782 H5751N probably benign Het
Eif2d A G 1: 131,173,343 E562G probably damaging Het
Epha10 A T 4: 124,913,988 probably benign Het
Epha4 C T 1: 77,374,867 G917D probably benign Het
Fap C T 2: 62,532,961 probably null Het
Fsd2 T C 7: 81,552,985 E282G probably benign Het
Gls A T 1: 52,191,157 M136K probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gusb T C 5: 129,998,526 T313A probably benign Het
Ints7 T C 1: 191,615,771 Y752H possibly damaging Het
Krt17 G A 11: 100,260,701 Q89* probably null Het
Mfsd4b4 T C 10: 39,892,471 I209V probably benign Het
Nr0b2 A G 4: 133,556,024 I191V probably benign Het
Olfr609 T C 7: 103,491,973 I302V probably benign Het
Pcdhb21 T C 18: 37,513,935 M39T probably benign Het
Pds5b T G 5: 150,746,608 Y354D probably benign Het
She A G 3: 89,849,581 D314G probably benign Het
Shpk T C 11: 73,215,120 M266T probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slfn4 T G 11: 83,187,199 V271G probably damaging Het
Slitrk6 C T 14: 110,750,373 R634H probably damaging Het
Trrap T C 5: 144,813,503 F1555L probably benign Het
Vldlr A C 19: 27,244,231 E665D probably benign Het
Whrn T C 4: 63,418,427 T633A probably benign Het
Xylt2 A G 11: 94,668,790 V342A probably benign Het
Zfp800 A T 6: 28,243,166 V600E probably benign Het
Other mutations in Btn2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Btn2a2 APN 13 23478576 missense probably damaging 1.00
IGL00740:Btn2a2 APN 13 23478485 missense probably benign
IGL02053:Btn2a2 APN 13 23478820 missense probably damaging 1.00
IGL02720:Btn2a2 APN 13 23480467 missense probably benign 0.15
IGL02738:Btn2a2 APN 13 23478806 nonsense probably null
IGL03010:Btn2a2 APN 13 23486205 nonsense probably null
IGL03221:Btn2a2 APN 13 23478449 missense probably damaging 1.00
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0597:Btn2a2 UTSW 13 23486410 missense probably benign 0.12
R0749:Btn2a2 UTSW 13 23478398 makesense probably null
R1209:Btn2a2 UTSW 13 23480566 critical splice donor site probably null
R1283:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R1718:Btn2a2 UTSW 13 23481936 missense probably benign 0.01
R2925:Btn2a2 UTSW 13 23481814 missense probably damaging 1.00
R3824:Btn2a2 UTSW 13 23480465 missense probably benign 0.02
R5356:Btn2a2 UTSW 13 23482875 missense probably benign 0.02
R5482:Btn2a2 UTSW 13 23486387 missense probably benign 0.03
R5535:Btn2a2 UTSW 13 23478275 missense probably benign 0.14
R5629:Btn2a2 UTSW 13 23481960 splice site probably null
R5930:Btn2a2 UTSW 13 23486228 missense probably damaging 0.96
R5952:Btn2a2 UTSW 13 23482808 missense probably benign 0.09
R6006:Btn2a2 UTSW 13 23486363 missense probably damaging 1.00
R6196:Btn2a2 UTSW 13 23487845 missense possibly damaging 0.74
R6373:Btn2a2 UTSW 13 23481829 missense probably benign 0.00
R6533:Btn2a2 UTSW 13 23481781 nonsense probably null
R6891:Btn2a2 UTSW 13 23482844 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTCTCTACAAACACCAATGGC -3'
(R):5'- CATCATCATGAGCTTCCTTGGG -3'

Sequencing Primer
(F):5'- GGCCCACACCATTACATTTTC -3'
(R):5'- CCTTCTTTGAAAAGGCCAC -3'
Posted On2016-07-22