Incidental Mutation 'R5282:Smox'
ID402806
Institutional Source Beutler Lab
Gene Symbol Smox
Ensembl Gene ENSMUSG00000027333
Gene Namespermine oxidase
SynonymsSMO, B130066H01Rik
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131491496-131525922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131521106 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 265 (V265D)
Ref Sequence ENSEMBL: ENSMUSP00000105810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028806] [ENSMUST00000110179] [ENSMUST00000110180] [ENSMUST00000110181] [ENSMUST00000110182] [ENSMUST00000110183] [ENSMUST00000110186] [ENSMUST00000110188] [ENSMUST00000110189] [ENSMUST00000129143] [ENSMUST00000183575] [ENSMUST00000183947]
Predicted Effect probably damaging
Transcript: ENSMUST00000028806
AA Change: V435D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028806
Gene: ENSMUSG00000027333
AA Change: V435D

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 7.2e-8 PFAM
Pfam:DAO 26 194 2.5e-9 PFAM
Pfam:NAD_binding_8 29 96 3.8e-18 PFAM
Pfam:Amino_oxidase 34 275 4.2e-27 PFAM
Pfam:Amino_oxidase 302 544 3.4e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110179
SMART Domains Protein: ENSMUSP00000105808
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 206 4.2e-10 PFAM
Pfam:Pyr_redox_3 28 101 2.3e-8 PFAM
Pfam:NAD_binding_8 29 96 1e-18 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110180
AA Change: V299D

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105809
Gene: ENSMUSG00000027333
AA Change: V299D

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 5e-8 PFAM
Pfam:DAO 26 196 1.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.5e-18 PFAM
Pfam:Amino_oxidase 34 272 2.2e-27 PFAM
Pfam:Amino_oxidase 277 408 3.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110181
AA Change: V265D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105810
Gene: ENSMUSG00000027333
AA Change: V265D

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 3.6e-8 PFAM
Pfam:DAO 26 202 8.9e-10 PFAM
Pfam:NAD_binding_8 29 96 1.2e-18 PFAM
Pfam:Amino_oxidase 34 116 2.1e-22 PFAM
Pfam:Amino_oxidase 197 374 1.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110182
SMART Domains Protein: ENSMUSP00000105811
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.2e-6 PFAM
Pfam:FAD_binding_2 26 87 1.6e-8 PFAM
Pfam:DAO 26 183 2.9e-9 PFAM
Pfam:Pyr_redox_3 28 103 1.4e-8 PFAM
Pfam:NAD_binding_8 29 96 6.3e-19 PFAM
Pfam:Amino_oxidase 34 118 3.6e-23 PFAM
Pfam:Amino_oxidase 129 179 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110183
SMART Domains Protein: ENSMUSP00000105812
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 227 5.1e-10 PFAM
Pfam:Pyr_redox_3 28 103 2.2e-8 PFAM
Pfam:NAD_binding_8 29 96 1.1e-18 PFAM
Pfam:Amino_oxidase 34 118 6.2e-23 PFAM
Pfam:Amino_oxidase 141 237 4.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110186
AA Change: V435D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105815
Gene: ENSMUSG00000027333
AA Change: V435D

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 78 1.7e-7 PFAM
Pfam:DAO 26 132 7.9e-9 PFAM
Pfam:NAD_binding_8 29 95 5.6e-18 PFAM
Pfam:Amino_oxidase 34 275 2.9e-28 PFAM
Pfam:Amino_oxidase 304 574 2.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110188
AA Change: V435D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105817
Gene: ENSMUSG00000027333
AA Change: V435D

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.9e-8 PFAM
Pfam:DAO 26 194 2.4e-9 PFAM
Pfam:NAD_binding_8 29 96 3.6e-18 PFAM
Pfam:Amino_oxidase 34 275 3.8e-27 PFAM
Pfam:Amino_oxidase 302 463 2.4e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110189
AA Change: V435D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105818
Gene: ENSMUSG00000027333
AA Change: V435D

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.5e-8 PFAM
Pfam:DAO 26 194 2.2e-9 PFAM
Pfam:NAD_binding_8 29 96 3.4e-18 PFAM
Pfam:Amino_oxidase 34 275 3.5e-27 PFAM
Pfam:Amino_oxidase 302 462 5.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129143
SMART Domains Protein: ENSMUSP00000120237
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 9.3e-7 PFAM
Pfam:FAD_binding_2 26 86 8.9e-9 PFAM
Pfam:DAO 26 190 1.6e-10 PFAM
Pfam:Pyr_redox_3 28 102 9.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.7e-19 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151627
Predicted Effect probably benign
Transcript: ENSMUST00000183575
SMART Domains Protein: ENSMUSP00000139099
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:Thi4 17 73 8.6e-7 PFAM
Pfam:FAD_binding_2 26 75 3.3e-9 PFAM
Pfam:DAO 26 79 4.2e-10 PFAM
Pfam:Pyr_redox 26 79 1.4e-7 PFAM
Pfam:Pyr_redox_3 28 77 2.1e-9 PFAM
Pfam:NAD_binding_8 29 80 6.8e-15 PFAM
Pfam:Amino_oxidase 34 76 3.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183881
Predicted Effect probably benign
Transcript: ENSMUST00000183947
SMART Domains Protein: ENSMUSP00000139278
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.4e-6 PFAM
Pfam:FAD_binding_2 26 85 1.8e-8 PFAM
Pfam:DAO 26 200 5e-10 PFAM
Pfam:Pyr_redox_3 28 102 1.7e-8 PFAM
Pfam:NAD_binding_8 29 96 7.7e-19 PFAM
Pfam:Amino_oxidase 34 118 4.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyamines are ubiquitous polycationic alkylamines which include spermine, spermidine, putrescine, and agmatine. These molecules participate in a broad range of cellular functions which include cell cycle modulation, scavenging reactive oxygen species, and the control of gene expression. These molecules also play important roles in neurotransmission through their regulation of cell-surface receptor activity, involvement in intracellular signalling pathways, and their putative roles as neurotransmitters. This gene encodes an FAD-containing enzyme that catalyzes the oxidation of spermine to spermadine and secondarily produces hydrogen peroxide. Multiple transcript variants encoding different isoenzymes have been identified for this gene, some of which have failed to demonstrate significant oxidase activity on natural polyamine substrates. The characterized isoenzymes have distinctive biochemical characteristics and substrate specificities, suggesting the existence of additional levels of complexity in polyamine catabolism. [provided by RefSeq, Jul 2012]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Smox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Smox APN 2 131512059 missense possibly damaging 0.91
IGL02022:Smox APN 2 131520117 missense probably damaging 0.98
R0368:Smox UTSW 2 131522158 missense probably damaging 1.00
R0411:Smox UTSW 2 131520644 missense probably benign 0.02
R1416:Smox UTSW 2 131522131 missense probably damaging 1.00
R1601:Smox UTSW 2 131520174 missense probably damaging 1.00
R1959:Smox UTSW 2 131520464 missense probably damaging 0.97
R2173:Smox UTSW 2 131512024 missense possibly damaging 0.91
R2215:Smox UTSW 2 131520270 critical splice donor site probably null
R4179:Smox UTSW 2 131524850 missense possibly damaging 0.84
R5630:Smox UTSW 2 131524866 nonsense probably null
R5979:Smox UTSW 2 131516414 missense probably damaging 0.99
R6984:Smox UTSW 2 131522111 missense possibly damaging 0.90
R6986:Smox UTSW 2 131522111 missense possibly damaging 0.90
X0026:Smox UTSW 2 131516235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCACTGACAAGATCTTCCTTG -3'
(R):5'- TCAGTGCCACAATCTGGAAAG -3'

Sequencing Primer
(F):5'- AGATCTTCCTTGAATTTGAGGAGCCC -3'
(R):5'- TGCCACAATCTGGAAAGGGTAAAAC -3'
Posted On2016-07-22