Incidental Mutation 'R5282:Tbck'
ID402808
Institutional Source Beutler Lab
Gene Symbol Tbck
Ensembl Gene ENSMUSG00000028030
Gene NameTBC1 domain containing kinase
SynonymsA630047E20Rik, C030007I09Rik, 1700120J03Rik
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location132684144-132841688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132751216 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 630 (M630I)
Ref Sequence ENSEMBL: ENSMUSP00000129205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169172]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000029664
SMART Domains Protein: ENSMUSP00000029664
Gene: ENSMUSG00000028030

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 6.2e-30 PFAM
Pfam:Pkinase 33 273 1.9e-39 PFAM
Pfam:Kinase-like 71 261 3.4e-8 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169172
AA Change: M630I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129205
Gene: ENSMUSG00000028030
AA Change: M630I

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 4.5e-29 PFAM
Pfam:Pkinase 32 273 1.4e-39 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
RHOD 780 886 2.67e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a protein kinase domain, a Rhodanase-like domain and the Tre-2/Bub2/Cdc16 (TBC) domain. The encoded protein is thought to play a role in actin organization, cell growth and cell proliferation by regulating the mammalian target of the rapamycin (mTOR) signaling pathway. This protein may also be involved in the transcriptional regulation of the components of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Tbck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tbck APN 3 132743093 splice site probably null
IGL00492:Tbck APN 3 132722740 missense probably benign 0.00
IGL01020:Tbck APN 3 132727142 nonsense probably null
IGL01111:Tbck APN 3 132694407 missense probably damaging 1.00
IGL01299:Tbck APN 3 132724877 missense probably damaging 0.98
IGL02456:Tbck APN 3 132734714 splice site probably benign
IGL02554:Tbck APN 3 132751192 nonsense probably null
IGL02640:Tbck APN 3 132774486 missense probably benign 0.26
IGL02960:Tbck APN 3 132722783 missense probably benign 0.01
IGL03184:Tbck APN 3 132736103 missense probably damaging 1.00
IGL03246:Tbck APN 3 132774570 missense probably benign
fear-4 UTSW 3 132724916 critical splice donor site probably null
Fuerchte UTSW 3 132722291 splice site probably benign
PIT1430001:Tbck UTSW 3 132722726 missense probably benign
PIT4802001:Tbck UTSW 3 132752666 missense probably damaging 1.00
R0113:Tbck UTSW 3 132743080 missense probably damaging 1.00
R0241:Tbck UTSW 3 132724875 missense probably benign
R0241:Tbck UTSW 3 132724875 missense probably benign
R0309:Tbck UTSW 3 132734407 nonsense probably null
R0375:Tbck UTSW 3 132751232 splice site probably benign
R0571:Tbck UTSW 3 132752642 missense probably damaging 1.00
R0831:Tbck UTSW 3 132722291 splice site probably benign
R1135:Tbck UTSW 3 132732191 missense probably damaging 0.97
R1184:Tbck UTSW 3 132837972 missense probably benign 0.01
R1560:Tbck UTSW 3 132838048 missense probably damaging 1.00
R1563:Tbck UTSW 3 132715693 missense possibly damaging 0.94
R1659:Tbck UTSW 3 132734355 missense probably damaging 1.00
R1799:Tbck UTSW 3 132774502 missense probably benign 0.01
R1830:Tbck UTSW 3 132838011 missense probably benign 0.40
R1884:Tbck UTSW 3 132724916 critical splice donor site probably null
R3406:Tbck UTSW 3 132727084 missense probably benign 0.41
R4021:Tbck UTSW 3 132727134 missense probably damaging 0.97
R4205:Tbck UTSW 3 132838028 missense probably benign 0.32
R4503:Tbck UTSW 3 132751220 missense probably benign 0.03
R4794:Tbck UTSW 3 132686968 missense possibly damaging 0.90
R4795:Tbck UTSW 3 132707798 missense possibly damaging 0.95
R4859:Tbck UTSW 3 132801527 missense probably benign 0.00
R5787:Tbck UTSW 3 132737568 missense probably damaging 1.00
R5987:Tbck UTSW 3 132801517 missense possibly damaging 0.53
R6145:Tbck UTSW 3 132732215 missense probably damaging 1.00
R6147:Tbck UTSW 3 132694446 missense probably benign
R6242:Tbck UTSW 3 132694428 missense probably benign 0.16
R6276:Tbck UTSW 3 132743005 missense probably damaging 1.00
R6912:Tbck UTSW 3 132686942 missense possibly damaging 0.50
R7107:Tbck UTSW 3 132722331 missense possibly damaging 0.73
R7191:Tbck UTSW 3 132737555 missense probably damaging 1.00
R7466:Tbck UTSW 3 132752563 missense probably damaging 0.99
X0018:Tbck UTSW 3 132686800 start codon destroyed probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCCGCATTTGTAAGATGG -3'
(R):5'- TCTAGGAAGTAGAACCAGGTGTTAAC -3'

Sequencing Primer
(F):5'- GCACCCGCATTTGTAAGATGGATAAC -3'
(R):5'- CCTGTACTAGGGCTTATAAAGTTGGC -3'
Posted On2016-07-22