Incidental Mutation 'R5282:Nub1'
ID402811
Institutional Source Beutler Lab
Gene Symbol Nub1
Ensembl Gene ENSMUSG00000028954
Gene Namenegative regulator of ubiquitin-like proteins 1
SynonymsNY-REN-18, 4931404D21Rik, 6330412F12Rik, BS4
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24685532-24710378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24695535 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 145 (F145L)
Ref Sequence ENSEMBL: ENSMUSP00000143657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068825] [ENSMUST00000197407]
Predicted Effect probably benign
Transcript: ENSMUST00000068825
AA Change: F121L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000070265
Gene: ENSMUSG00000028954
AA Change: F121L

DomainStartEndE-ValueType
coiled coil region 37 70 N/A INTRINSIC
PDB:1WJU|A 71 162 2e-45 PDB
low complexity region 167 186 N/A INTRINSIC
UBA 375 412 7.29e-8 SMART
UBA 431 468 1.61e-9 SMART
UBA 490 527 1.95e-8 SMART
low complexity region 539 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181925
Predicted Effect probably benign
Transcript: ENSMUST00000197407
AA Change: F145L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143657
Gene: ENSMUSG00000028954
AA Change: F145L

DomainStartEndE-ValueType
coiled coil region 61 94 N/A INTRINSIC
PDB:1WJU|A 95 186 2e-45 PDB
low complexity region 191 210 N/A INTRINSIC
UBA 399 436 3.5e-10 SMART
UBA 455 492 8.1e-12 SMART
UBA 514 551 9.5e-11 SMART
low complexity region 563 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200337
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a negative regulator of NEDD8, a ubiquitin-like protein that conjugates with cullin family members in order to regulate vital biological events. The protein encoded by this gene regulates the NEDD8 conjugation system post-transcriptionally by recruiting NEDD8 and its conjugates to the proteasome for degradation. This protein interacts with the product of the AIPL1 gene, which is associated with Leber congenital amaurosis, an inherited retinopathy, and mutations in that gene can abolish interaction with this protein, which may contribute to the pathogenesis. This protein is also known to accumulate in Lewy bodies in Parkinson's disease and dementia with Lewy bodies, and in glial cytoplasmic inclusions in multiple system atrophy, with this abnormal accumulation being specific to alpha-synucleinopathy lesions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Nub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Nub1 APN 5 24689394 start codon destroyed probably null 0.99
IGL02626:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02629:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02633:Nub1 APN 5 24692933 missense probably benign 0.00
IGL02798:Nub1 APN 5 24692814 missense probably damaging 1.00
IGL03384:Nub1 APN 5 24697427 splice site probably benign
IGL03384:Nub1 APN 5 24697426 splice site probably null
R2484:Nub1 UTSW 5 24708702 missense possibly damaging 0.91
R2679:Nub1 UTSW 5 24692925 missense possibly damaging 0.93
R3825:Nub1 UTSW 5 24707853 missense probably benign 0.21
R4180:Nub1 UTSW 5 24692877 missense probably damaging 0.99
R4593:Nub1 UTSW 5 24709121 missense probably damaging 1.00
R4921:Nub1 UTSW 5 24701469 missense probably benign 0.38
R5175:Nub1 UTSW 5 24702448 missense probably benign 0.28
R5346:Nub1 UTSW 5 24697416 missense probably damaging 0.96
R5533:Nub1 UTSW 5 24702381 missense possibly damaging 0.93
R5567:Nub1 UTSW 5 24708816 missense possibly damaging 0.54
R5802:Nub1 UTSW 5 24702441 missense possibly damaging 0.95
R6966:Nub1 UTSW 5 24689472 missense probably damaging 1.00
R6967:Nub1 UTSW 5 24708711 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCGCTTGGAGTATTATTGTACTG -3'
(R):5'- TTTCCCACTAGCCAGAGCAG -3'

Sequencing Primer
(F):5'- GGAGTATTATTGTACTGTGATGCTC -3'
(R):5'- CCAGAGCAGGCCAGTGATTATTTAC -3'
Posted On2016-07-22