Incidental Mutation 'R0415:Thbs2'
ID40283
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
MMRRC Submission 038617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R0415 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 14679973 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 573 (S573A)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably benign
Transcript: ENSMUST00000170872
AA Change: S573A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: S573A

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 23,831,050 noncoding transcript Het
Acox2 A G 14: 8,243,835 probably benign Het
Adgb T C 10: 10,431,067 probably null Het
Adgra3 C A 5: 49,961,757 probably benign Het
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ahnak A G 19: 9,012,871 probably benign Het
Anapc2 A G 2: 25,278,325 T159A probably damaging Het
Arfgef3 A G 10: 18,613,127 probably benign Het
Atf7ip C T 6: 136,560,012 S81L possibly damaging Het
Cacna1i A G 15: 80,368,830 probably benign Het
Camk1 A T 6: 113,341,891 Y20* probably null Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
Cd109 T A 9: 78,712,615 S1380T probably benign Het
Cfap57 A T 4: 118,569,431 L1107Q possibly damaging Het
Col6a4 C T 9: 106,075,080 V540I probably damaging Het
Cst9 T A 2: 148,838,442 probably benign Het
Cul5 C T 9: 53,667,070 V73I probably benign Het
Cxcl16 T A 11: 70,458,748 K84* probably null Het
Cyp2c29 T C 19: 39,329,095 probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dip2c C T 13: 9,568,289 probably benign Het
Dis3 A T 14: 99,087,456 I513N probably damaging Het
Dnajc16 A T 4: 141,789,048 L3* probably null Het
Dopey1 T A 9: 86,506,502 L480M probably damaging Het
Eml6 A G 11: 29,749,392 V1787A possibly damaging Het
Etnk1 A G 6: 143,180,774 N115S probably damaging Het
Fryl T C 5: 73,098,414 Y758C probably damaging Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Ggnbp2 A C 11: 84,833,225 probably benign Het
Gm7137 A G 10: 77,788,173 probably benign Het
Gstm2 T A 3: 107,984,006 Q132L probably benign Het
Habp2 T C 19: 56,317,717 probably benign Het
Hectd2 T C 19: 36,584,884 probably benign Het
Htr6 A G 4: 139,062,081 I291T possibly damaging Het
Ighg2c T C 12: 113,287,910 D199G unknown Het
Itih2 A G 2: 10,105,615 probably benign Het
Kcnab2 A G 4: 152,395,136 F248S probably benign Het
Kcnc4 T C 3: 107,445,433 K610E probably damaging Het
Kcnk16 T A 14: 20,262,975 probably null Het
Kndc1 C T 7: 139,930,124 T1293I probably damaging Het
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Lrrc8d T C 5: 105,811,865 L47P probably damaging Het
Lyst T C 13: 13,711,610 probably benign Het
Macrod2 G A 2: 142,210,145 probably null Het
Micalcl C T 7: 112,381,028 R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,841,339 probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nup205 T C 6: 35,214,634 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Olfr229 A G 9: 39,909,983 Y60C probably damaging Het
Olfr78 C T 7: 102,742,087 M305I probably benign Het
Olfr893 A T 9: 38,209,973 M305L probably benign Het
Pard3 G A 8: 127,610,566 G1221D probably damaging Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Pcsk6 C T 7: 66,033,874 R746C probably damaging Het
Pif1 G A 9: 65,588,051 C81Y probably benign Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plcd4 C A 1: 74,552,097 S217Y probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Het
Polr2k A G 15: 36,175,456 Y45C probably damaging Het
Pqlc3 C A 12: 16,997,710 probably benign Het
Prex1 A G 2: 166,586,699 probably benign Het
Pth2r A G 1: 65,388,439 M424V probably benign Het
Pygm A G 19: 6,391,366 R464G probably benign Het
Rad51c A G 11: 87,397,655 L234P probably damaging Het
Rnf145 A G 11: 44,525,138 Y60C probably damaging Het
Rnf167 T C 11: 70,649,699 I135T probably damaging Het
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Het
Selenbp1 T C 3: 94,936,913 V27A possibly damaging Het
Selenof T G 3: 144,577,692 L14R probably damaging Het
Sfswap A T 5: 129,504,126 D121V probably damaging Het
Slc25a34 C A 4: 141,620,469 M300I possibly damaging Het
Slc34a3 T G 2: 25,229,110 T583P probably benign Het
Smg1 C A 7: 118,182,468 A1199S probably benign Het
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Sptbn1 A C 11: 30,149,576 N229K probably damaging Het
Sult2b1 A G 7: 45,730,092 probably benign Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Tmem132c A G 5: 127,563,705 E980G probably damaging Het
Tmem247 G T 17: 86,922,322 C197F probably damaging Het
Tmem251 T A 12: 102,744,876 Y119* probably null Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Het
Tmprss13 A G 9: 45,337,132 probably null Het
Trove2 G T 1: 143,760,075 N444K probably benign Het
Ubr5 T C 15: 37,972,980 T2626A probably damaging Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Het
Vmn1r22 G T 6: 57,900,332 T220K probably benign Het
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Vmn2r74 A C 7: 85,961,410 C25G probably damaging Het
Xndc1 T C 7: 102,080,616 probably benign Het
Zfp282 A G 6: 47,897,881 D340G probably damaging Het
Zfp282 T A 6: 47,905,053 I558N possibly damaging Het
Zfp316 T A 5: 143,264,491 T56S unknown Het
Zfp345 A G 2: 150,474,559 probably benign Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
R7183:Thbs2 UTSW 17 14690116 missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14671458 missense probably damaging 1.00
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTGACCACAGCACACTGTGAG -3'
(R):5'- CAAGAGAAGCTGCCCTATTGGTGAG -3'

Sequencing Primer
(F):5'- GCACACTGTGAGGACAAAC -3'
(R):5'- TGgtgagtgagtgtgtgtg -3'
Posted On2013-05-23