Incidental Mutation 'R5283:Gon4l'
ID402861
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission 042868-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R5283 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88887590 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 700 (L700P)
Ref Sequence ENSEMBL: ENSMUSP00000103122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
Predicted Effect probably damaging
Transcript: ENSMUST00000081695
AA Change: L700P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: L700P

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090942
AA Change: L701P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: L701P

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107498
AA Change: L700P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: L700P

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198251
Predicted Effect probably damaging
Transcript: ENSMUST00000212694
AA Change: L400P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,159,853 D93N probably benign Het
Aamp C T 1: 74,284,006 E53K possibly damaging Het
Amotl1 T C 9: 14,558,484 E651G probably damaging Het
Ankrd11 A C 8: 122,884,182 V2655G probably damaging Het
Apbb1ip G A 2: 22,867,671 V434M probably benign Het
Atp5h T C 11: 115,415,785 Y150C probably damaging Het
BC117090 T C 16: 36,321,843 D57G probably damaging Het
Ccdc13 T A 9: 121,808,188 D75V probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crh T C 3: 19,694,007 H157R probably damaging Het
Dpp4 G A 2: 62,360,336 T392I probably damaging Het
Ehd3 G T 17: 73,820,503 A144S probably benign Het
Fnip2 A T 3: 79,465,708 I1021N probably damaging Het
Fus T A 7: 127,985,547 probably benign Het
Glo1 T C 17: 30,600,073 T92A probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15130 A C 2: 111,135,409 M165R unknown Het
Gm9573 A G 17: 35,621,332 probably benign Het
Grm1 C A 10: 10,733,192 D566Y possibly damaging Het
Guca1b T C 17: 47,391,270 probably benign Het
Has3 A G 8: 106,874,115 M70V probably damaging Het
Hydin G T 8: 110,451,980 C1069F possibly damaging Het
Ints1 A C 5: 139,764,382 L920R probably damaging Het
Kdm2a T C 19: 4,331,269 I54V probably benign Het
Kpna2 G A 11: 106,990,832 T324I probably damaging Het
Lrr1 T C 12: 69,174,654 L190S probably damaging Het
Lrrc49 A T 9: 60,687,178 H16Q probably benign Het
Mapkap1 A G 2: 34,444,348 E147G probably damaging Het
Mrpl2 C T 17: 46,649,066 R219W possibly damaging Het
Ndc80 A G 17: 71,521,135 S66P probably benign Het
Notch1 A G 2: 26,468,626 Y1398H probably damaging Het
Olfml2b C T 1: 170,681,189 R539* probably null Het
Olfr6 T A 7: 106,956,748 T63S probably benign Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Plekhg1 G A 10: 3,956,654 V524I probably benign Het
Plin4 T A 17: 56,106,777 M283L probably benign Het
Prp2 C T 6: 132,600,643 P298S unknown Het
Rap1gap2 G A 11: 74,395,825 R550C probably damaging Het
Reln G A 5: 22,011,163 T1008I probably damaging Het
Rffl T C 11: 82,812,789 K103E probably damaging Het
Rmnd5b A T 11: 51,627,060 F156I probably damaging Het
Rtn4ip1 T C 10: 43,902,465 I68T probably damaging Het
Samhd1 T C 2: 157,109,492 I442V possibly damaging Het
Slc12a4 A T 8: 105,950,694 probably null Het
Slc35b1 G T 11: 95,384,988 probably benign Het
Ssh1 A G 5: 113,950,545 V354A probably damaging Het
Stk33 T C 7: 109,336,127 K153E possibly damaging Het
Stk4 C T 2: 164,110,279 R19* probably null Het
Tas2r136 A T 6: 132,777,411 I251N probably damaging Het
Tbr1 A T 2: 61,804,900 T65S probably benign Het
Tkt C T 14: 30,560,618 S124F probably damaging Het
Tll1 T C 8: 64,101,966 I228V possibly damaging Het
Tmem236 A G 2: 14,174,833 I82V probably benign Het
Vmn2r110 T C 17: 20,580,637 Q511R probably benign Het
Vmn2r98 T C 17: 19,080,719 M661T probably benign Het
Vps13a T A 19: 16,677,970 K1898I probably damaging Het
Zc3h12a T C 4: 125,126,765 E95G probably benign Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 intron probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
R7355:Gon4l UTSW 3 88863520 missense probably damaging 1.00
R7426:Gon4l UTSW 3 88907522 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTCTCTAGTTTGAGGGTCAAG -3'
(R):5'- TCATGCAAACAGAGGAAGTCAC -3'

Sequencing Primer
(F):5'- CTCTAGTTTGAGGGTCAAGTTTGTC -3'
(R):5'- TCACAGGACAGGCAGGTAC -3'
Posted On2016-07-22