Incidental Mutation 'R5283:Slc35b1'
ID402889
Institutional Source Beutler Lab
Gene Symbol Slc35b1
Ensembl Gene ENSMUSG00000020873
Gene Namesolute carrier family 35, member B1
SynonymsUgalt2
MMRRC Submission 042868-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5283 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location95384692-95391776 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 95384988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021243] [ENSMUST00000037502] [ENSMUST00000131193] [ENSMUST00000146556] [ENSMUST00000232252]
Predicted Effect silent
Transcript: ENSMUST00000021243
SMART Domains Protein: ENSMUSP00000021243
Gene: ENSMUSG00000020873

DomainStartEndE-ValueType
Pfam:TPT 12 309 1.3e-14 PFAM
Pfam:UAA 13 313 2.1e-58 PFAM
Pfam:EamA 170 309 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037502
SMART Domains Protein: ENSMUSP00000049162
Gene: ENSMUSG00000038893

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
Pfam:FAM117 86 397 3.6e-116 PFAM
Predicted Effect silent
Transcript: ENSMUST00000131193
SMART Domains Protein: ENSMUSP00000125307
Gene: ENSMUSG00000020873

DomainStartEndE-ValueType
Pfam:UAA 14 91 5.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143090
Predicted Effect silent
Transcript: ENSMUST00000146556
SMART Domains Protein: ENSMUSP00000125597
Gene: ENSMUSG00000020873

DomainStartEndE-ValueType
low complexity region 14 23 N/A INTRINSIC
Pfam:EmrE 38 149 3.9e-9 PFAM
Pfam:UAA 46 153 4.5e-30 PFAM
Pfam:EamA 63 146 1.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189860
Predicted Effect probably benign
Transcript: ENSMUST00000232252
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotide sugar transporter which is a member of solute carrier family 35. The transporters in this family are highly conserved hydrophobic proteins with multiple transmembrane domains. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,159,853 D93N probably benign Het
Aamp C T 1: 74,284,006 E53K possibly damaging Het
Amotl1 T C 9: 14,558,484 E651G probably damaging Het
Ankrd11 A C 8: 122,884,182 V2655G probably damaging Het
Apbb1ip G A 2: 22,867,671 V434M probably benign Het
Atp5h T C 11: 115,415,785 Y150C probably damaging Het
BC117090 T C 16: 36,321,843 D57G probably damaging Het
Ccdc13 T A 9: 121,808,188 D75V probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crh T C 3: 19,694,007 H157R probably damaging Het
Dpp4 G A 2: 62,360,336 T392I probably damaging Het
Ehd3 G T 17: 73,820,503 A144S probably benign Het
Fnip2 A T 3: 79,465,708 I1021N probably damaging Het
Fus T A 7: 127,985,547 probably benign Het
Glo1 T C 17: 30,600,073 T92A probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15130 A C 2: 111,135,409 M165R unknown Het
Gm9573 A G 17: 35,621,332 probably benign Het
Gon4l T C 3: 88,887,590 L700P probably damaging Het
Grm1 C A 10: 10,733,192 D566Y possibly damaging Het
Guca1b T C 17: 47,391,270 probably benign Het
Has3 A G 8: 106,874,115 M70V probably damaging Het
Hydin G T 8: 110,451,980 C1069F possibly damaging Het
Ints1 A C 5: 139,764,382 L920R probably damaging Het
Kdm2a T C 19: 4,331,269 I54V probably benign Het
Kpna2 G A 11: 106,990,832 T324I probably damaging Het
Lrr1 T C 12: 69,174,654 L190S probably damaging Het
Lrrc49 A T 9: 60,687,178 H16Q probably benign Het
Mapkap1 A G 2: 34,444,348 E147G probably damaging Het
Mrpl2 C T 17: 46,649,066 R219W possibly damaging Het
Ndc80 A G 17: 71,521,135 S66P probably benign Het
Notch1 A G 2: 26,468,626 Y1398H probably damaging Het
Olfml2b C T 1: 170,681,189 R539* probably null Het
Olfr6 T A 7: 106,956,748 T63S probably benign Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Plekhg1 G A 10: 3,956,654 V524I probably benign Het
Plin4 T A 17: 56,106,777 M283L probably benign Het
Prp2 C T 6: 132,600,643 P298S unknown Het
Rap1gap2 G A 11: 74,395,825 R550C probably damaging Het
Reln G A 5: 22,011,163 T1008I probably damaging Het
Rffl T C 11: 82,812,789 K103E probably damaging Het
Rmnd5b A T 11: 51,627,060 F156I probably damaging Het
Rtn4ip1 T C 10: 43,902,465 I68T probably damaging Het
Samhd1 T C 2: 157,109,492 I442V possibly damaging Het
Slc12a4 A T 8: 105,950,694 probably null Het
Ssh1 A G 5: 113,950,545 V354A probably damaging Het
Stk33 T C 7: 109,336,127 K153E possibly damaging Het
Stk4 C T 2: 164,110,279 R19* probably null Het
Tas2r136 A T 6: 132,777,411 I251N probably damaging Het
Tbr1 A T 2: 61,804,900 T65S probably benign Het
Tkt C T 14: 30,560,618 S124F probably damaging Het
Tll1 T C 8: 64,101,966 I228V possibly damaging Het
Tmem236 A G 2: 14,174,833 I82V probably benign Het
Vmn2r110 T C 17: 20,580,637 Q511R probably benign Het
Vmn2r98 T C 17: 19,080,719 M661T probably benign Het
Vps13a T A 19: 16,677,970 K1898I probably damaging Het
Zc3h12a T C 4: 125,126,765 E95G probably benign Het
Other mutations in Slc35b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc35b1 APN 11 95389084 missense probably benign 0.01
IGL03151:Slc35b1 APN 11 95390386 critical splice donor site probably null
R0026:Slc35b1 UTSW 11 95390642 missense probably benign
R0026:Slc35b1 UTSW 11 95390642 missense probably benign
R0125:Slc35b1 UTSW 11 95386527 missense probably benign 0.01
R1331:Slc35b1 UTSW 11 95385863 missense probably damaging 1.00
R2061:Slc35b1 UTSW 11 95385892 missense possibly damaging 0.72
R2192:Slc35b1 UTSW 11 95385814 missense probably damaging 1.00
R5484:Slc35b1 UTSW 11 95387805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTTCCTTCTTTCCTAGAACG -3'
(R):5'- TGGTGGAGACTGAATTCCGG -3'

Sequencing Primer
(F):5'- TCCTAGAACGCTCCTGCCG -3'
(R):5'- AGACTGAATTCCGGCCCTG -3'
Posted On2016-07-22