Incidental Mutation 'R5284:Fastkd1'
ID402916
Institutional Source Beutler Lab
Gene Symbol Fastkd1
Ensembl Gene ENSMUSG00000027086
Gene NameFAST kinase domains 1
Synonyms5330408N05Rik
MMRRC Submission 042841-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R5284 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69686815-69713516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69712188 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 92 (T92A)
Ref Sequence ENSEMBL: ENSMUSP00000099767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073152] [ENSMUST00000102706]
Predicted Effect probably benign
Transcript: ENSMUST00000073152
AA Change: T92A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072896
Gene: ENSMUSG00000027086
AA Change: T92A

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 560 628 6.6e-25 PFAM
Pfam:FAST_2 645 730 6.4e-26 PFAM
RAP 763 822 4.38e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102706
AA Change: T92A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099767
Gene: ENSMUSG00000027086
AA Change: T92A

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 530 600 2.2e-26 PFAM
Pfam:FAST_2 614 701 4.4e-31 PFAM
RAP 734 793 4.38e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140776
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T A 7: 45,981,059 Q1259L probably benign Het
AI314180 C T 4: 58,836,172 E723K possibly damaging Het
Arhgef26 T C 3: 62,419,631 S522P probably damaging Het
Asic5 C T 3: 82,008,523 P218L probably damaging Het
Atad1 T C 19: 32,687,271 M248V probably benign Het
Bank1 T C 3: 136,064,154 D522G probably damaging Het
Bod1l G A 5: 41,820,467 S1168L probably benign Het
Cactin A G 10: 81,323,762 D51G probably damaging Het
Camkk1 A G 11: 73,037,555 D261G probably benign Het
Cep152 A G 2: 125,580,021 S930P probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crim1 A T 17: 78,313,266 R378S possibly damaging Het
Dcun1d4 T C 5: 73,522,682 probably null Het
Dhdds A G 4: 133,980,212 V187A probably benign Het
Egfem1 A G 3: 29,650,787 E251G possibly damaging Het
Ehhadh T C 16: 21,763,344 probably null Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Epb41l4a T A 18: 33,798,800 T581S probably damaging Het
Erg C T 16: 95,459,243 M1I probably null Het
Gabpb1 T C 2: 126,652,357 H116R possibly damaging Het
Gucy2c A G 6: 136,763,043 L262P possibly damaging Het
Ifi203 C T 1: 173,928,708 probably benign Het
Kcnk13 A C 12: 100,061,289 I208L probably benign Het
Klhl7 A G 5: 24,159,617 T550A probably benign Het
Krtap12-1 G T 10: 77,720,965 C114F possibly damaging Het
Myh7b A G 2: 155,632,314 T1650A probably benign Het
Myo19 T A 11: 84,885,272 probably null Het
Nav1 C T 1: 135,449,963 W1656* probably null Het
Nup188 A T 2: 30,330,635 S907C probably damaging Het
Olfr212 T A 6: 116,516,552 Y258* probably null Het
Oplah A T 15: 76,306,559 H125Q probably benign Het
Pcnx A T 12: 81,919,029 T657S probably benign Het
Phf14 C A 6: 11,997,120 Q796K probably damaging Het
Plaa T C 4: 94,569,637 I699V probably benign Het
Prex2 C A 1: 11,266,090 S1504* probably null Het
Prpf18 G A 2: 4,645,670 Q50* probably null Het
Rnf213 A G 11: 119,458,866 Y3851C possibly damaging Het
Rpgrip1 A G 14: 52,149,276 D726G probably damaging Het
Sacm1l T C 9: 123,586,420 S487P probably damaging Het
Setdb1 G T 3: 95,327,570 R941S probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Smg8 G A 11: 87,080,311 S878L possibly damaging Het
Trpc4 T A 3: 54,279,947 V440E probably damaging Het
Tsen15 A G 1: 152,371,873 S123P probably damaging Het
Tspan12 G T 6: 21,835,467 A69D probably damaging Het
Ubiad1 G A 4: 148,436,498 T223M probably damaging Het
Ubtfl1 A T 9: 18,409,445 K90* probably null Het
Wdr19 C T 5: 65,225,409 T492I probably damaging Het
Zfp423 C T 8: 87,781,677 D659N possibly damaging Het
Other mutations in Fastkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fastkd1 APN 2 69707549 missense probably benign 0.02
IGL00702:Fastkd1 APN 2 69708545 missense probably damaging 0.99
IGL00960:Fastkd1 APN 2 69694653 splice site probably benign
IGL01154:Fastkd1 APN 2 69690060 splice site probably null
IGL01463:Fastkd1 APN 2 69690061 critical splice donor site probably null
IGL01913:Fastkd1 APN 2 69708501 splice site probably benign
IGL01977:Fastkd1 APN 2 69694588 missense possibly damaging 0.64
IGL02408:Fastkd1 APN 2 69702601 missense probably benign
IGL02715:Fastkd1 APN 2 69712125 critical splice donor site probably null
IGL03411:Fastkd1 APN 2 69707359 missense probably damaging 0.99
PIT4519001:Fastkd1 UTSW 2 69690157 missense probably damaging 0.97
R0541:Fastkd1 UTSW 2 69702406 missense probably damaging 1.00
R0612:Fastkd1 UTSW 2 69712383 missense probably benign 0.03
R1170:Fastkd1 UTSW 2 69708649 splice site probably benign
R1499:Fastkd1 UTSW 2 69708638 critical splice acceptor site probably null
R1586:Fastkd1 UTSW 2 69712148 missense probably benign 0.43
R1698:Fastkd1 UTSW 2 69702469 missense probably benign 0.22
R2172:Fastkd1 UTSW 2 69700133 missense probably damaging 1.00
R2240:Fastkd1 UTSW 2 69696953 missense probably benign 0.01
R2327:Fastkd1 UTSW 2 69705528 nonsense probably null
R2897:Fastkd1 UTSW 2 69702616 missense probably damaging 1.00
R4120:Fastkd1 UTSW 2 69707310 missense probably damaging 0.98
R4544:Fastkd1 UTSW 2 69712311 missense probably damaging 1.00
R4546:Fastkd1 UTSW 2 69712311 missense probably damaging 1.00
R4798:Fastkd1 UTSW 2 69691307 missense probably benign 0.38
R4993:Fastkd1 UTSW 2 69702740 missense probably damaging 0.99
R5668:Fastkd1 UTSW 2 69707381 missense possibly damaging 0.92
R6869:Fastkd1 UTSW 2 69702760 missense probably benign 0.02
R6870:Fastkd1 UTSW 2 69708614 missense probably benign 0.05
R7062:Fastkd1 UTSW 2 69704322 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGGCTAGCCATGTCTACATTCC -3'
(R):5'- ACAAACGAAGAACAAGTGTTTGACC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- TGACCTTATTGAGACGAATACGG -3'
Posted On2016-07-22