Incidental Mutation 'R5284:Setdb1'
ID402924
Institutional Source Beutler Lab
Gene Symbol Setdb1
Ensembl Gene ENSMUSG00000015697
Gene NameSET domain, bifurcated 1
SynonymsKMT1E, ESET
MMRRC Submission 042841-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5284 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95323525-95357202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95327570 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 941 (R941S)
Ref Sequence ENSEMBL: ENSMUSP00000102788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000015858] [ENSMUST00000107170] [ENSMUST00000107171]
Predicted Effect probably damaging
Transcript: ENSMUST00000015841
AA Change: R941S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697
AA Change: R941S

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000015858
SMART Domains Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 332 1.17e-81 SMART
low complexity region 337 360 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107170
AA Change: R941S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697
AA Change: R941S

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107171
AA Change: R940S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697
AA Change: R940S

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134702
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous inactivation of this locus results in peri-implantation lethality. Inner cell mass growth is impaired in null blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T A 7: 45,981,059 Q1259L probably benign Het
AI314180 C T 4: 58,836,172 E723K possibly damaging Het
Arhgef26 T C 3: 62,419,631 S522P probably damaging Het
Asic5 C T 3: 82,008,523 P218L probably damaging Het
Atad1 T C 19: 32,687,271 M248V probably benign Het
Bank1 T C 3: 136,064,154 D522G probably damaging Het
Bod1l G A 5: 41,820,467 S1168L probably benign Het
Cactin A G 10: 81,323,762 D51G probably damaging Het
Camkk1 A G 11: 73,037,555 D261G probably benign Het
Cep152 A G 2: 125,580,021 S930P probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crim1 A T 17: 78,313,266 R378S possibly damaging Het
Dcun1d4 T C 5: 73,522,682 probably null Het
Dhdds A G 4: 133,980,212 V187A probably benign Het
Egfem1 A G 3: 29,650,787 E251G possibly damaging Het
Ehhadh T C 16: 21,763,344 probably null Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Epb41l4a T A 18: 33,798,800 T581S probably damaging Het
Erg C T 16: 95,459,243 M1I probably null Het
Fastkd1 T C 2: 69,712,188 T92A probably benign Het
Gabpb1 T C 2: 126,652,357 H116R possibly damaging Het
Gucy2c A G 6: 136,763,043 L262P possibly damaging Het
Ifi203 C T 1: 173,928,708 probably benign Het
Kcnk13 A C 12: 100,061,289 I208L probably benign Het
Klhl7 A G 5: 24,159,617 T550A probably benign Het
Krtap12-1 G T 10: 77,720,965 C114F possibly damaging Het
Myh7b A G 2: 155,632,314 T1650A probably benign Het
Myo19 T A 11: 84,885,272 probably null Het
Nav1 C T 1: 135,449,963 W1656* probably null Het
Nup188 A T 2: 30,330,635 S907C probably damaging Het
Olfr212 T A 6: 116,516,552 Y258* probably null Het
Oplah A T 15: 76,306,559 H125Q probably benign Het
Pcnx A T 12: 81,919,029 T657S probably benign Het
Phf14 C A 6: 11,997,120 Q796K probably damaging Het
Plaa T C 4: 94,569,637 I699V probably benign Het
Prex2 C A 1: 11,266,090 S1504* probably null Het
Prpf18 G A 2: 4,645,670 Q50* probably null Het
Rnf213 A G 11: 119,458,866 Y3851C possibly damaging Het
Rpgrip1 A G 14: 52,149,276 D726G probably damaging Het
Sacm1l T C 9: 123,586,420 S487P probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Smg8 G A 11: 87,080,311 S878L possibly damaging Het
Trpc4 T A 3: 54,279,947 V440E probably damaging Het
Tsen15 A G 1: 152,371,873 S123P probably damaging Het
Tspan12 G T 6: 21,835,467 A69D probably damaging Het
Ubiad1 G A 4: 148,436,498 T223M probably damaging Het
Ubtfl1 A T 9: 18,409,445 K90* probably null Het
Wdr19 C T 5: 65,225,409 T492I probably damaging Het
Zfp423 C T 8: 87,781,677 D659N possibly damaging Het
Other mutations in Setdb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Setdb1 APN 3 95338577 missense probably damaging 1.00
IGL00915:Setdb1 APN 3 95346788 missense probably damaging 1.00
IGL01339:Setdb1 APN 3 95338580 nonsense probably null
IGL01710:Setdb1 APN 3 95338853 missense probably damaging 1.00
IGL02795:Setdb1 APN 3 95327373 missense probably damaging 1.00
IGL02824:Setdb1 APN 3 95339904 splice site probably benign
IGL02838:Setdb1 APN 3 95337268 splice site probably null
IGL03014:Setdb1 UTSW 3 95341415 missense probably damaging 1.00
R0077:Setdb1 UTSW 3 95341451 missense probably damaging 1.00
R0344:Setdb1 UTSW 3 95326131 unclassified probably benign
R0367:Setdb1 UTSW 3 95349881 splice site probably benign
R0374:Setdb1 UTSW 3 95324853 unclassified probably benign
R0411:Setdb1 UTSW 3 95327686 missense probably damaging 1.00
R0501:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0521:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0616:Setdb1 UTSW 3 95341798 missense probably damaging 1.00
R0828:Setdb1 UTSW 3 95338860 missense probably damaging 1.00
R0990:Setdb1 UTSW 3 95340265 missense probably benign 0.00
R1263:Setdb1 UTSW 3 95327611 missense probably damaging 0.99
R1297:Setdb1 UTSW 3 95349876 splice site probably benign
R1497:Setdb1 UTSW 3 95327467 missense probably benign 0.44
R2885:Setdb1 UTSW 3 95340195 missense probably benign
R2907:Setdb1 UTSW 3 95327201 splice site probably benign
R3236:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3237:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3972:Setdb1 UTSW 3 95341338 missense probably damaging 1.00
R4260:Setdb1 UTSW 3 95327497 missense probably damaging 0.96
R5484:Setdb1 UTSW 3 95337258 missense probably damaging 1.00
R5955:Setdb1 UTSW 3 95338842 missense probably damaging 1.00
R6542:Setdb1 UTSW 3 95340307 missense probably damaging 1.00
R6610:Setdb1 UTSW 3 95328577 missense probably damaging 1.00
R6632:Setdb1 UTSW 3 95324149 missense probably damaging 1.00
R6785:Setdb1 UTSW 3 95326401 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACGAGGCCACCTTGTTCTTG -3'
(R):5'- GATGAGTACTTTGCAAATCTGGAC -3'

Sequencing Primer
(F):5'- GCCACCTTGTTCTTGGGTGTC -3'
(R):5'- TCTGGACCACATTGAAAGTGTG -3'
Posted On2016-07-22