Incidental Mutation 'R5284:Bank1'
ID402925
Institutional Source Beutler Lab
Gene Symbol Bank1
Ensembl Gene ENSMUSG00000037922
Gene NameB cell scaffold protein with ankyrin repeats 1
SynonymsA530094C12Rik
MMRRC Submission 042841-MU
Accession Numbers

Genbank: NM_001033350.2

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5284 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location136053363-136326066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136064154 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 522 (D522G)
Ref Sequence ENSEMBL: ENSMUSP00000142996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041577] [ENSMUST00000196159] [ENSMUST00000198206]
Predicted Effect probably damaging
Transcript: ENSMUST00000041577
AA Change: D723G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035484
Gene: ENSMUSG00000037922
AA Change: D723G

DomainStartEndE-ValueType
DBB 197 327 1.24e-62 SMART
Blast:ANK 341 371 7e-12 BLAST
SCOP:d1awcb_ 344 398 2e-4 SMART
Blast:ANK 377 407 2e-6 BLAST
coiled coil region 465 486 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
coiled coil region 560 583 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196159
AA Change: D590G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142366
Gene: ENSMUSG00000037922
AA Change: D590G

DomainStartEndE-ValueType
DBB 64 194 1.24e-62 SMART
Blast:ANK 208 238 6e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 3e-6 BLAST
coiled coil region 332 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 427 450 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198206
AA Change: D522G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142996
Gene: ENSMUSG00000037922
AA Change: D522G

DomainStartEndE-ValueType
DBB 64 194 5.9e-67 SMART
Blast:ANK 208 238 5e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 2e-6 BLAST
low complexity region 300 313 N/A INTRINSIC
coiled coil region 359 382 N/A INTRINSIC
low complexity region 408 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198354
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell-specific scaffold protein that functions in B-cell receptor-induced calcium mobilization from intracellular stores. This protein can also promote Lyn-mediated tyrosine phosphorylation of inositol 1,4,5-trisphosphate receptors. Polymorphisms in this gene are associated with susceptibility to systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased germinal center formation and IgM production in response to T-dependent antigens, and show enhanced CD40-mediated B cell proliferative and survival responses. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T A 7: 45,981,059 Q1259L probably benign Het
AI314180 C T 4: 58,836,172 E723K possibly damaging Het
Arhgef26 T C 3: 62,419,631 S522P probably damaging Het
Asic5 C T 3: 82,008,523 P218L probably damaging Het
Atad1 T C 19: 32,687,271 M248V probably benign Het
Bod1l G A 5: 41,820,467 S1168L probably benign Het
Cactin A G 10: 81,323,762 D51G probably damaging Het
Camkk1 A G 11: 73,037,555 D261G probably benign Het
Cep152 A G 2: 125,580,021 S930P probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crim1 A T 17: 78,313,266 R378S possibly damaging Het
Dcun1d4 T C 5: 73,522,682 probably null Het
Dhdds A G 4: 133,980,212 V187A probably benign Het
Egfem1 A G 3: 29,650,787 E251G possibly damaging Het
Ehhadh T C 16: 21,763,344 probably null Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Epb41l4a T A 18: 33,798,800 T581S probably damaging Het
Erg C T 16: 95,459,243 M1I probably null Het
Fastkd1 T C 2: 69,712,188 T92A probably benign Het
Gabpb1 T C 2: 126,652,357 H116R possibly damaging Het
Gucy2c A G 6: 136,763,043 L262P possibly damaging Het
Ifi203 C T 1: 173,928,708 probably benign Het
Kcnk13 A C 12: 100,061,289 I208L probably benign Het
Klhl7 A G 5: 24,159,617 T550A probably benign Het
Krtap12-1 G T 10: 77,720,965 C114F possibly damaging Het
Myh7b A G 2: 155,632,314 T1650A probably benign Het
Myo19 T A 11: 84,885,272 probably null Het
Nav1 C T 1: 135,449,963 W1656* probably null Het
Nup188 A T 2: 30,330,635 S907C probably damaging Het
Olfr212 T A 6: 116,516,552 Y258* probably null Het
Oplah A T 15: 76,306,559 H125Q probably benign Het
Pcnx A T 12: 81,919,029 T657S probably benign Het
Phf14 C A 6: 11,997,120 Q796K probably damaging Het
Plaa T C 4: 94,569,637 I699V probably benign Het
Prex2 C A 1: 11,266,090 S1504* probably null Het
Prpf18 G A 2: 4,645,670 Q50* probably null Het
Rnf213 A G 11: 119,458,866 Y3851C possibly damaging Het
Rpgrip1 A G 14: 52,149,276 D726G probably damaging Het
Sacm1l T C 9: 123,586,420 S487P probably damaging Het
Setdb1 G T 3: 95,327,570 R941S probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Smg8 G A 11: 87,080,311 S878L possibly damaging Het
Trpc4 T A 3: 54,279,947 V440E probably damaging Het
Tsen15 A G 1: 152,371,873 S123P probably damaging Het
Tspan12 G T 6: 21,835,467 A69D probably damaging Het
Ubiad1 G A 4: 148,436,498 T223M probably damaging Het
Ubtfl1 A T 9: 18,409,445 K90* probably null Het
Wdr19 C T 5: 65,225,409 T492I probably damaging Het
Zfp423 C T 8: 87,781,677 D659N possibly damaging Het
Other mutations in Bank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Bank1 APN 3 136247634 missense probably damaging 0.99
IGL03088:Bank1 APN 3 136093362 missense probably damaging 0.98
IGL03190:Bank1 APN 3 136100424 missense probably damaging 1.00
I2289:Bank1 UTSW 3 136054418 missense probably damaging 1.00
PIT4504001:Bank1 UTSW 3 136100419 missense probably damaging 1.00
R0193:Bank1 UTSW 3 136066518 splice site probably benign
R0423:Bank1 UTSW 3 136284017 missense possibly damaging 0.68
R0518:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0521:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0587:Bank1 UTSW 3 136214037 splice site probably benign
R0628:Bank1 UTSW 3 136066390 missense probably damaging 1.00
R0723:Bank1 UTSW 3 136054403 splice site probably null
R0811:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R0812:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R1101:Bank1 UTSW 3 136283864 missense probably benign 0.08
R1446:Bank1 UTSW 3 136064143 missense probably damaging 1.00
R1564:Bank1 UTSW 3 136213841 nonsense probably null
R1636:Bank1 UTSW 3 136083226 missense probably damaging 1.00
R1667:Bank1 UTSW 3 136093296 missense probably damaging 1.00
R1751:Bank1 UTSW 3 136234614 missense probably benign 0.00
R1751:Bank1 UTSW 3 136254937 missense probably benign 0.00
R2023:Bank1 UTSW 3 136325918 missense probably benign 0.02
R2851:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R2852:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R3411:Bank1 UTSW 3 136247773 splice site probably benign
R4422:Bank1 UTSW 3 136083211 missense probably damaging 0.99
R4499:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4693:Bank1 UTSW 3 136247676 missense probably damaging 0.99
R4744:Bank1 UTSW 3 136247689 missense probably benign 0.12
R4791:Bank1 UTSW 3 136254929 missense probably benign 0.00
R4911:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4967:Bank1 UTSW 3 136066373 missense probably damaging 1.00
R4979:Bank1 UTSW 3 136254901 missense probably damaging 0.99
R5119:Bank1 UTSW 3 136234682 missense possibly damaging 0.67
R5547:Bank1 UTSW 3 136066349 missense probably damaging 0.99
R5610:Bank1 UTSW 3 136066387 missense probably damaging 1.00
R6012:Bank1 UTSW 3 136213837 missense probably benign 0.44
R6087:Bank1 UTSW 3 136066429 missense probably damaging 1.00
R6753:Bank1 UTSW 3 136093308 missense probably damaging 1.00
R6764:Bank1 UTSW 3 136242940 missense probably damaging 0.97
R6861:Bank1 UTSW 3 136255003 missense probably benign 0.33
R7013:Bank1 UTSW 3 136100509 missense possibly damaging 0.74
R7436:Bank1 UTSW 3 136055800 missense possibly damaging 0.76
V1662:Bank1 UTSW 3 136054418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGGACATGTGACTAATCCTG -3'
(R):5'- ACAGGACGCTACTGTTTTACATC -3'

Sequencing Primer
(F):5'- TCCTGTTTAGTAGAGAAGGAACC -3'
(R):5'- GGACGCTACTGTTTTACATCTACTTC -3'
Posted On2016-07-22