Incidental Mutation 'R5284:Kcnk13'
ID402955
Institutional Source Beutler Lab
Gene Symbol Kcnk13
Ensembl Gene ENSMUSG00000045404
Gene Namepotassium channel, subfamily K, member 13
SynonymsLOC381712, F730021E22Rik, LOC380778
MMRRC Submission 042841-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5284 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location99964499-100062682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 100061289 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 208 (I208L)
Ref Sequence ENSEMBL: ENSMUSP00000136882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049788] [ENSMUST00000160413] [ENSMUST00000177549]
Predicted Effect probably benign
Transcript: ENSMUST00000049788
AA Change: I208L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000051846
Gene: ENSMUSG00000045404
AA Change: I208L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Ion_trans_2 75 151 4.7e-18 PFAM
Pfam:Ion_trans_2 195 285 3.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160413
AA Change: I208L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123916
Gene: ENSMUSG00000045404
AA Change: I208L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Ion_trans_2 74 151 6e-17 PFAM
Pfam:Ion_trans_2 195 285 7.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177549
AA Change: I208L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000136882
Gene: ENSMUSG00000045404
AA Change: I208L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Ion_trans_2 75 151 4.7e-18 PFAM
Pfam:Ion_trans_2 195 285 3.3e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a potassium channel containing two pore-forming domains. This protein is an open channel that can be stimulated by arachidonic acid and inhibited by the anesthetic halothane. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout reduces the surveillance activity of microglial cells in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T A 7: 45,981,059 Q1259L probably benign Het
AI314180 C T 4: 58,836,172 E723K possibly damaging Het
Arhgef26 T C 3: 62,419,631 S522P probably damaging Het
Asic5 C T 3: 82,008,523 P218L probably damaging Het
Atad1 T C 19: 32,687,271 M248V probably benign Het
Bank1 T C 3: 136,064,154 D522G probably damaging Het
Bod1l G A 5: 41,820,467 S1168L probably benign Het
Cactin A G 10: 81,323,762 D51G probably damaging Het
Camkk1 A G 11: 73,037,555 D261G probably benign Het
Cep152 A G 2: 125,580,021 S930P probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crim1 A T 17: 78,313,266 R378S possibly damaging Het
Dcun1d4 T C 5: 73,522,682 probably null Het
Dhdds A G 4: 133,980,212 V187A probably benign Het
Egfem1 A G 3: 29,650,787 E251G possibly damaging Het
Ehhadh T C 16: 21,763,344 probably null Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Epb41l4a T A 18: 33,798,800 T581S probably damaging Het
Erg C T 16: 95,459,243 M1I probably null Het
Fastkd1 T C 2: 69,712,188 T92A probably benign Het
Gabpb1 T C 2: 126,652,357 H116R possibly damaging Het
Gucy2c A G 6: 136,763,043 L262P possibly damaging Het
Ifi203 C T 1: 173,928,708 probably benign Het
Klhl7 A G 5: 24,159,617 T550A probably benign Het
Krtap12-1 G T 10: 77,720,965 C114F possibly damaging Het
Myh7b A G 2: 155,632,314 T1650A probably benign Het
Myo19 T A 11: 84,885,272 probably null Het
Nav1 C T 1: 135,449,963 W1656* probably null Het
Nup188 A T 2: 30,330,635 S907C probably damaging Het
Olfr212 T A 6: 116,516,552 Y258* probably null Het
Oplah A T 15: 76,306,559 H125Q probably benign Het
Pcnx A T 12: 81,919,029 T657S probably benign Het
Phf14 C A 6: 11,997,120 Q796K probably damaging Het
Plaa T C 4: 94,569,637 I699V probably benign Het
Prex2 C A 1: 11,266,090 S1504* probably null Het
Prpf18 G A 2: 4,645,670 Q50* probably null Het
Rnf213 A G 11: 119,458,866 Y3851C possibly damaging Het
Rpgrip1 A G 14: 52,149,276 D726G probably damaging Het
Sacm1l T C 9: 123,586,420 S487P probably damaging Het
Setdb1 G T 3: 95,327,570 R941S probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Smg8 G A 11: 87,080,311 S878L possibly damaging Het
Trpc4 T A 3: 54,279,947 V440E probably damaging Het
Tsen15 A G 1: 152,371,873 S123P probably damaging Het
Tspan12 G T 6: 21,835,467 A69D probably damaging Het
Ubiad1 G A 4: 148,436,498 T223M probably damaging Het
Ubtfl1 A T 9: 18,409,445 K90* probably null Het
Wdr19 C T 5: 65,225,409 T492I probably damaging Het
Zfp423 C T 8: 87,781,677 D659N possibly damaging Het
Other mutations in Kcnk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Kcnk13 APN 12 100061662 missense probably benign 0.06
IGL01829:Kcnk13 APN 12 100060998 splice site probably benign
IGL01940:Kcnk13 APN 12 100061424 missense probably benign 0.01
IGL02549:Kcnk13 APN 12 100061751 nonsense probably null
IGL03105:Kcnk13 APN 12 100061110 missense probably damaging 1.00
R4730:Kcnk13 UTSW 12 100061715 missense probably damaging 0.98
R4851:Kcnk13 UTSW 12 99966124 missense probably damaging 0.98
R5411:Kcnk13 UTSW 12 100061251 missense probably damaging 1.00
R6254:Kcnk13 UTSW 12 99965372 start gained probably benign
R6836:Kcnk13 UTSW 12 100061689 missense probably damaging 0.98
R6862:Kcnk13 UTSW 12 100061689 missense probably damaging 0.98
R6863:Kcnk13 UTSW 12 100061689 missense probably damaging 0.98
R6897:Kcnk13 UTSW 12 100061767 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GTCATCGCCTGTGTCATGAG -3'
(R):5'- ACAGTCTGTTTGATCAGGATGG -3'

Sequencing Primer
(F):5'- GTGTCATGAGATCCTGTCACCAG -3'
(R):5'- GTAGATGCAGCAGACACCCATG -3'
Posted On2016-07-22