Incidental Mutation 'R5285:Zfp7'
ID403017
Institutional Source Beutler Lab
Gene Symbol Zfp7
Ensembl Gene ENSMUSG00000033669
Gene Namezinc finger protein 7
SynonymsKRAB20, Zfp-7, Zfp86-rs1, Zfp65, Zfp80, KRAB7, Krox-2, mszf73-2
MMRRC Submission 042869-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5285 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76879259-76892395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76891222 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 488 (R488Q)
Ref Sequence ENSEMBL: ENSMUSP00000155599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023179] [ENSMUST00000229831] [ENSMUST00000229990] [ENSMUST00000230106] [ENSMUST00000230214]
Predicted Effect probably damaging
Transcript: ENSMUST00000023179
AA Change: R488Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023179
Gene: ENSMUSG00000033669
AA Change: R488Q

DomainStartEndE-ValueType
KRAB 4 65 3.07e-33 SMART
ZnF_C2H2 192 214 6.88e-4 SMART
ZnF_C2H2 220 242 4.24e-4 SMART
ZnF_C2H2 248 270 2.09e-3 SMART
ZnF_C2H2 276 298 1.45e-2 SMART
ZnF_C2H2 304 326 1.13e-4 SMART
ZnF_C2H2 332 354 9.08e-4 SMART
ZnF_C2H2 360 383 2.24e-3 SMART
ZnF_C2H2 412 434 9.08e-4 SMART
ZnF_C2H2 440 462 1.67e-2 SMART
ZnF_C2H2 468 490 3.44e-4 SMART
ZnF_C2H2 496 518 8.47e-4 SMART
ZnF_C2H2 524 546 4.54e-4 SMART
ZnF_C2H2 552 574 7.9e-4 SMART
ZnF_C2H2 580 602 1.72e-4 SMART
ZnF_C2H2 633 655 1.98e-4 SMART
ZnF_C2H2 661 683 4.79e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229782
Predicted Effect probably benign
Transcript: ENSMUST00000229831
Predicted Effect probably benign
Transcript: ENSMUST00000229990
Predicted Effect probably damaging
Transcript: ENSMUST00000230106
AA Change: R488Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230954
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,708,465 T12A probably benign Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adcy8 G T 15: 64,767,857 H685N possibly damaging Het
Aldh1l1 A T 6: 90,576,770 K539* probably null Het
Ap1m2 G T 9: 21,305,637 Y134* probably null Het
Apobr A G 7: 126,585,003 probably benign Het
Atl1 A G 12: 69,954,499 K345R probably benign Het
Avil T C 10: 127,018,459 L765P probably damaging Het
Caps2 T A 10: 112,208,311 Y472N probably benign Het
Cd177 A T 7: 24,746,249 S590T probably benign Het
Cep295 T C 9: 15,322,591 D2223G probably benign Het
Cfh T C 1: 140,100,898 T493A probably benign Het
Chek1 T C 9: 36,714,452 D299G probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Crhr1 A T 11: 104,170,497 I243F possibly damaging Het
Cyp3a11 A G 5: 145,855,083 V500A probably benign Het
Dcdc5 A T 2: 106,368,155 noncoding transcript Het
Ergic3 A G 2: 156,018,037 probably benign Het
Fabp3-ps1 T G 10: 86,732,202 probably benign Het
Gm16432 A G 1: 178,103,888 K458E unknown Het
Gm6445 C A 19: 9,607,668 noncoding transcript Het
Gucy2d C A 7: 98,458,267 probably null Het
Ighv1-19-1 C A 12: 114,704,252 probably benign Het
Igkv2-116 G T 6: 68,152,479 R75L probably benign Het
Inhbc C A 10: 127,357,400 R249L probably damaging Het
Lrrn2 T A 1: 132,939,245 S683T possibly damaging Het
Lyst T C 13: 13,634,426 V227A probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Msh4 T C 3: 153,873,713 N587S probably benign Het
Mug1 G A 6: 121,841,107 E126K probably benign Het
Nav2 T C 7: 49,548,234 S1204P probably damaging Het
Ncor1 A G 11: 62,392,649 I413T probably damaging Het
Nipa2 A T 7: 55,933,012 Y328* probably null Het
Olfr178 A T 16: 58,890,108 Y37* probably null Het
Olfr195 T C 16: 59,149,270 L140P probably damaging Het
Olfr384 T A 11: 73,602,941 Y120* probably null Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr645 A G 7: 104,084,133 *316R probably null Het
Pla2g4e T C 2: 120,189,504 D155G probably damaging Het
Plxnb1 C T 9: 109,108,459 T1176I probably damaging Het
Polg A G 7: 79,465,225 probably benign Het
Prl8a2 G A 13: 27,350,133 probably null Het
Prmt7 G A 8: 106,248,359 R529Q probably benign Het
Psg17 T A 7: 18,820,201 L41F probably benign Het
Rad18 T C 6: 112,686,765 R73G probably benign Het
Rhpn2 G T 7: 35,381,565 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sarm1 A G 11: 78,497,439 F7S probably benign Het
Sgip1 T A 4: 102,921,477 probably benign Het
Sh3gl2 A G 4: 85,376,449 K99R probably benign Het
Sorbs1 G A 19: 40,321,890 T1018I probably damaging Het
Spns2 G A 11: 72,489,479 A106V possibly damaging Het
Stab1 A G 14: 31,143,476 probably benign Het
Steap3 T C 1: 120,241,880 D191G probably damaging Het
Stxbp5 T C 10: 9,798,275 probably null Het
Sycp2 A T 2: 178,392,398 probably null Het
Tm6sf1 A G 7: 81,859,452 S2G possibly damaging Het
Usp24 T A 4: 106,407,033 D1720E probably benign Het
Vmn1r200 G A 13: 22,395,287 E78K possibly damaging Het
Vmn2r120 A G 17: 57,536,703 L47P probably damaging Het
Vmn2r14 T C 5: 109,217,576 N544S probably damaging Het
Vwa1 C T 4: 155,770,895 A254T probably benign Het
Zfp940 A T 7: 29,845,600 L294H probably damaging Het
Other mutations in Zfp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp7 APN 15 76890901 intron probably benign
IGL01509:Zfp7 APN 15 76881133 missense probably damaging 1.00
IGL01694:Zfp7 APN 15 76890795 nonsense probably null
IGL01731:Zfp7 APN 15 76888305 nonsense probably null
IGL02025:Zfp7 APN 15 76888264 missense probably damaging 1.00
R0841:Zfp7 UTSW 15 76891504 missense probably damaging 1.00
R1345:Zfp7 UTSW 15 76890708 missense probably damaging 1.00
R1625:Zfp7 UTSW 15 76881174 missense probably damaging 1.00
R1872:Zfp7 UTSW 15 76891777 missense probably benign 0.00
R2330:Zfp7 UTSW 15 76891309 missense probably damaging 1.00
R4170:Zfp7 UTSW 15 76891618 missense probably benign 0.00
R4795:Zfp7 UTSW 15 76891346 nonsense probably null
R4796:Zfp7 UTSW 15 76891346 nonsense probably null
R5038:Zfp7 UTSW 15 76891810 missense probably benign 0.01
R5277:Zfp7 UTSW 15 76881203 missense probably damaging 1.00
R5287:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5445:Zfp7 UTSW 15 76890854 nonsense probably null
R5655:Zfp7 UTSW 15 76891429 missense probably damaging 1.00
R6320:Zfp7 UTSW 15 76890610 missense possibly damaging 0.79
R7063:Zfp7 UTSW 15 76891719 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCTTTCAGGTGGCTCTCTC -3'
(R):5'- GTGTTCAATAAGGTATGAGCTCCG -3'

Sequencing Primer
(F):5'- CTGAATCAGCACCAGGTGG -3'
(R):5'- ACACTCGTTACACGTATAAGGTCTC -3'
Posted On2016-07-22