Incidental Mutation 'R5209:Adgb'
ID403048
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission 042784-MU
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5209 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10398937 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 759 (V759L)
Ref Sequence ENSEMBL: ENSMUSP00000136386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000045328
SMART Domains Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 11 257 1e-165 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132573
SMART Domains Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172530
AA Change: V757L

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: V757L

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179956
AA Change: V759L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: V759L

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208717
AA Change: V733L

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,818 T4453A possibly damaging Het
Abca14 T C 7: 120,232,907 V500A probably benign Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Adprhl1 T A 8: 13,242,563 K243* probably null Het
Arhgap24 T A 5: 102,892,149 D317E probably benign Het
Arhgef5 A T 6: 43,273,700 I462F probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Btbd18 A G 2: 84,668,099 T694A possibly damaging Het
Ces1d A T 8: 93,175,188 probably benign Het
Chmp2a C A 7: 13,032,674 V106F probably damaging Het
Cinp T C 12: 110,874,060 E219G probably benign Het
Col5a3 C T 9: 20,778,643 probably benign Het
Dnhd1 T G 7: 105,696,460 S2271A probably benign Het
Epg5 T A 18: 77,951,282 L376H probably damaging Het
Fam81a T C 9: 70,125,160 T17A probably benign Het
Fgd2 T A 17: 29,368,376 probably null Het
Gjc3 C T 5: 137,957,271 V251I probably benign Het
Gnaz T G 10: 74,991,991 F192V probably benign Het
Hmgcr T C 13: 96,666,512 probably benign Het
Mamdc4 G T 2: 25,566,923 A614E probably damaging Het
Mapk8ip2 A T 15: 89,459,287 Q713L probably damaging Het
Mettl1 T C 10: 127,045,334 V238A possibly damaging Het
Ms4a4c G A 19: 11,416,438 G74E probably damaging Het
Msh3 A G 13: 92,344,954 probably null Het
Mtmr14 T A 6: 113,253,775 Y113* probably null Het
Mylk T C 16: 34,922,625 L1169P possibly damaging Het
Npr3 A G 15: 11,848,603 V426A possibly damaging Het
Olfr105-ps T C 17: 37,382,830 S88P probably damaging Het
Olfr221 T C 14: 52,035,953 T53A probably benign Het
Olfr771 A C 10: 129,160,932 D17E possibly damaging Het
Olfr905 T A 9: 38,473,521 M258K possibly damaging Het
Pcdhb17 T C 18: 37,487,461 F768S probably damaging Het
Piezo2 T C 18: 63,032,929 N2077S probably damaging Het
Pkd1l2 G A 8: 117,056,442 P713L probably benign Het
Primpol T C 8: 46,590,260 T333A probably benign Het
Pth2r A T 1: 65,388,697 T510S probably benign Het
Ptprr A T 10: 116,162,609 E208V probably damaging Het
Rag1 T C 2: 101,644,215 Y194C probably benign Het
Reep5 A T 18: 34,357,240 probably null Het
Rexo5 T A 7: 119,834,299 Y493* probably null Het
Rgs9 T C 11: 109,239,594 probably null Het
Rps6ka1 A T 4: 133,865,818 V218D probably damaging Het
Satb1 A T 17: 51,809,207 M16K probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn14 A G 11: 83,279,633 F395S possibly damaging Het
Sptbn5 T A 2: 120,072,002 I82F probably benign Het
Stam T A 2: 14,146,347 I505K probably benign Het
Tesk2 G A 4: 116,724,698 probably benign Het
Trappc12 T C 12: 28,737,794 K430R probably benign Het
Trmo T C 4: 46,387,740 N34D probably damaging Het
Ubr2 C A 17: 46,968,424 C686F probably damaging Het
Vdac1 C T 11: 52,376,452 T60I probably damaging Het
Zfp652 G C 11: 95,763,665 R478P possibly damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GTGGTTCTCAGAGATCACACCTC -3'
(R):5'- TGCAAATCTAGGTAGTTATCCCTTC -3'

Sequencing Primer
(F):5'- GATCACACCTCACCATTTATTAGAGG -3'
(R):5'- CTAGCAGAGGTGAAATGC -3'
Posted On2016-07-22