Incidental Mutation 'R5212:Med20'
ID403214
Institutional Source Beutler Lab
Gene Symbol Med20
Ensembl Gene ENSMUSG00000092558
Gene Namemediator complex subunit 20
SynonymsTrfp, 1110011O05Rik, 2410115I17Rik
MMRRC Submission 042786-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5212 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47611582-47624418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47618850 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 71 (Y71H)
Ref Sequence ENSEMBL: ENSMUSP00000117658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024778] [ENSMUST00000132397]
Predicted Effect probably benign
Transcript: ENSMUST00000024778
AA Change: Y71H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024778
Gene: ENSMUSG00000092558
AA Change: Y71H

DomainStartEndE-ValueType
Pfam:Med20 1 198 6.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130830
Predicted Effect probably benign
Transcript: ENSMUST00000132397
AA Change: Y71H

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117658
Gene: ENSMUSG00000023984
AA Change: Y71H

DomainStartEndE-ValueType
Pfam:Med20 1 149 1.6e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149893
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. A mutation in this gene has been associated with a novel infantile-onset neurodegenerative movement disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,065,850 S267T possibly damaging Het
Abca9 T C 11: 110,107,226 D1514G probably benign Het
Adamtsl4 T A 3: 95,677,670 D896V probably damaging Het
Amer2 A G 14: 60,379,820 Y362C probably damaging Het
Arglu1 T A 8: 8,683,843 R158W probably damaging Het
Arhgef7 A G 8: 11,728,388 E46G probably benign Het
Atg2b A G 12: 105,646,796 V1172A probably benign Het
Bhlhe23 T A 2: 180,776,093 K217N probably damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Ccp110 C T 7: 118,729,696 A845V probably damaging Het
Cd63 A G 10: 128,911,853 Y105C probably damaging Het
Cdk11b T C 4: 155,638,615 probably null Het
Clip1 T A 5: 123,630,681 R618S probably benign Het
Crybg1 A T 10: 43,967,743 F1731L possibly damaging Het
Dock1 A C 7: 134,789,194 K728Q possibly damaging Het
Emc2 A G 15: 43,510,844 E180G probably damaging Het
F13b A T 1: 139,512,987 I394F probably benign Het
Fnta A G 8: 26,009,707 I155T probably benign Het
Fshr T A 17: 88,986,256 E331D probably benign Het
Fshr T A 17: 88,986,257 E331V probably benign Het
Gas2l1 A T 11: 5,061,108 C574S probably benign Het
Ggnbp2 T A 11: 84,854,021 probably benign Het
Gm3371 A C 14: 44,403,654 probably benign Het
Gm7489 T A 15: 53,885,620 probably benign Het
Hand1 A C 11: 57,831,447 F114V probably damaging Het
Itga4 A C 2: 79,280,595 H259P probably damaging Het
Jakmip1 A T 5: 37,104,901 H183L probably benign Het
Kif1bp A T 10: 62,563,129 probably benign Het
Krt8 G T 15: 101,997,967 A369D possibly damaging Het
Krt82 T C 15: 101,545,049 S301G probably damaging Het
Lig3 A G 11: 82,787,678 T248A probably benign Het
Madcam1 C G 10: 79,668,345 T255S probably benign Het
Mtss1l A G 8: 110,729,218 I107V probably damaging Het
Nans T C 4: 46,502,547 F328S possibly damaging Het
Ncbp3 A G 11: 73,053,547 probably benign Het
Nek8 T C 11: 78,172,516 M1V probably null Het
Nufip1 A T 14: 76,133,098 N413I possibly damaging Het
Pbx3 T C 2: 34,288,781 probably benign Het
Plppr3 C T 10: 79,862,445 G419R probably benign Het
Rfx1 G T 8: 84,066,592 probably benign Het
Rnpepl1 C T 1: 92,911,323 A68V probably benign Het
Rsbn1l A T 5: 20,896,214 M776K probably benign Het
Setd7 A T 3: 51,542,817 Y63N probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snap47 T C 11: 59,428,352 E320G probably damaging Het
Spaca6 C A 17: 17,838,394 P68Q probably benign Het
Tdrd3 G C 14: 87,506,215 R527P probably damaging Het
Tmprss2 G T 16: 97,576,292 Q202K probably benign Het
Tmprss6 A G 15: 78,446,260 V69A probably damaging Het
Trav6-1 A T 14: 52,638,704 Q27L probably benign Het
Ttn T C 2: 76,789,601 I15908V probably benign Het
Ttn T A 2: 76,797,675 D12931V probably damaging Het
Ttn C T 2: 76,901,613 probably benign Het
Ush2a T A 1: 188,444,705 probably null Het
Wls A G 3: 159,873,008 N69S probably benign Het
Other mutations in Med20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Med20 APN 17 47623000 missense possibly damaging 0.92
R0847:Med20 UTSW 17 47611693 critical splice donor site probably null
R0881:Med20 UTSW 17 47611680 start codon destroyed probably null 1.00
R4460:Med20 UTSW 17 47618917 missense probably benign 0.39
R4461:Med20 UTSW 17 47618917 missense probably benign 0.39
R5605:Med20 UTSW 17 47623144 intron probably benign
V7580:Med20 UTSW 17 47618832 missense probably damaging 1.00
V7582:Med20 UTSW 17 47618832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTCTGGAAAAGGCTAGC -3'
(R):5'- CTTACCTCCACAGAGATGCC -3'

Sequencing Primer
(F):5'- AGGCTAGCACTTAAGGATCCTTC -3'
(R):5'- ATTGTGACCGTGCCCAC -3'
Posted On2016-07-22