Incidental Mutation 'R5213:Aqr'
ID403233
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Nameaquarius
Synonyms
MMRRC Submission 042854-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5213 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location114101170-114187024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114113327 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1110 (N1110S)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
Predicted Effect probably damaging
Transcript: ENSMUST00000043160
AA Change: N1110S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: N1110S

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102543
AA Change: N1110S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: N1110S

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140441
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,326,053 P199Q possibly damaging Het
4430402I18Rik A T 19: 28,963,564 V50E probably benign Het
Adamtsl1 C A 4: 86,385,628 H1342N possibly damaging Het
Adcy2 G T 13: 68,620,823 T1062K possibly damaging Het
Atp10a C T 7: 58,773,983 T232I probably damaging Het
Atp5f1 T A 3: 105,955,911 K70* probably null Het
Atp8b4 A C 2: 126,389,409 probably null Het
Atraid A C 5: 31,052,208 Q72P probably damaging Het
Atxn2 G T 5: 121,814,480 probably null Het
Best3 A T 10: 117,024,472 T546S probably benign Het
Brd3 T C 2: 27,463,948 K51E possibly damaging Het
Brip1 A G 11: 86,143,321 S525P possibly damaging Het
Ccdc109b A C 3: 129,916,997 F262C probably benign Het
Cenpf A G 1: 189,654,980 I1701T probably benign Het
Chrna9 A T 5: 65,971,084 K208* probably null Het
Clec2l T A 6: 38,680,192 C197S probably damaging Het
Crp A G 1: 172,698,519 H57R probably benign Het
Cyp27b1 C A 10: 127,052,095 T492N probably damaging Het
Dock4 A T 12: 40,676,742 I340F probably damaging Het
Dsg1b A T 18: 20,395,930 D241V probably damaging Het
Epg5 G T 18: 78,014,834 V1865L probably benign Het
Erap1 A G 13: 74,671,495 probably null Het
Fat2 C T 11: 55,253,832 C4072Y probably benign Het
Fat4 T A 3: 38,980,191 I2664N possibly damaging Het
Gabrp A G 11: 33,567,211 probably null Het
Glis2 G T 16: 4,614,082 probably benign Het
Gm11487 G T 4: 73,401,334 Q302K probably damaging Het
Gm17654 A G 14: 43,579,102 S15P probably damaging Het
Gm21836 A G 9: 124,493,753 V14A unknown Het
Gon7 G A 12: 102,754,121 T84I possibly damaging Het
Greb1 G T 12: 16,714,790 Y447* probably null Het
Grip2 A T 6: 91,779,831 D546E probably benign Het
Hectd1 A G 12: 51,802,533 probably null Het
Il1f6 T A 2: 24,224,474 F120L probably damaging Het
Itga4 T C 2: 79,320,576 V842A probably benign Het
Khsrp G A 17: 57,024,366 A404V probably benign Het
Map3k11 T C 19: 5,690,641 V132A probably damaging Het
Mysm1 A T 4: 94,948,377 V732E probably damaging Het
Npr2 T A 4: 43,640,673 probably null Het
Olfr101 T C 17: 37,300,051 I124V probably damaging Het
Olfr172 T C 16: 58,760,621 Y185C probably damaging Het
Olfr975 A C 9: 39,950,093 I226S probably damaging Het
Oxgr1 G T 14: 120,022,140 Y218* probably null Het
Paf1 A G 7: 28,395,972 Q161R possibly damaging Het
Pck1 A T 2: 173,156,085 K316* probably null Het
Plac8 T A 5: 100,556,505 M109L probably benign Het
Plagl2 A T 2: 153,232,319 C221S probably damaging Het
Polg T C 7: 79,454,098 D870G probably damaging Het
Polr2k T A 15: 36,174,997 M1K probably null Het
Prdm9 T C 17: 15,555,154 H276R probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Serpina3i A G 12: 104,265,655 I184V probably benign Het
Shank3 A G 15: 89,533,278 E26G possibly damaging Het
Skil T C 3: 31,117,451 S575P probably damaging Het
Slc13a1 A G 6: 24,108,159 L306P probably damaging Het
Slc20a1 G T 2: 129,200,509 W166L probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snrnp200 G T 2: 127,231,741 G1353V probably damaging Het
Sphkap A G 1: 83,280,503 I173T probably damaging Het
Stab2 A T 10: 86,907,197 F1183I probably damaging Het
Stard9 A G 2: 120,699,226 D1988G probably damaging Het
Tank T A 2: 61,649,948 I276N probably benign Het
Tcaf3 A G 6: 42,591,467 W652R probably damaging Het
Tgm2 G A 2: 158,143,060 T42I possibly damaging Het
Tnni2 G T 7: 142,443,302 probably null Het
Tns1 A G 1: 73,953,612 S9P probably damaging Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Trdv2-1 T C 14: 53,946,406 S32P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Trpm3 T G 19: 22,697,454 Y72* probably null Het
Ube2o G A 11: 116,541,459 P894S possibly damaging Het
Ubr4 C T 4: 139,402,566 R666* probably null Het
Ugt1a8 T A 1: 88,088,123 L86* probably null Het
Usp32 T A 11: 85,022,259 N941I probably damaging Het
Utrn C T 10: 12,636,760 V2322M probably damaging Het
Vmn1r184 A T 7: 26,267,711 Y294F probably damaging Het
Vmn2r108 T C 17: 20,471,493 N256S probably benign Het
Wdr7 T C 18: 63,755,126 S557P probably damaging Het
Xrra1 C A 7: 99,898,483 P293Q possibly damaging Het
Zc3h18 A G 8: 122,383,649 D79G probably damaging Het
Zfp74 A T 7: 29,935,243 Y347N probably damaging Het
Zfp740 T C 15: 102,212,647 C169R possibly damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTAGGTTTGTAGAGGAGGCTAAAAC -3'
(R):5'- GCTGCTGAAGGTTGGGAATC -3'

Sequencing Primer
(F):5'- GAGGAGGCTAAAACTTTTTGTAACAG -3'
(R):5'- CATGATGTCGTCTGATGAACAG -3'
Posted On2016-07-22