Incidental Mutation 'R5213:Stard9'
ID403234
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 042854-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R5213 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120699226 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1988 (D1988G)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000180041]
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180041
AA Change: D1988G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: D1988G

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,326,053 P199Q possibly damaging Het
4430402I18Rik A T 19: 28,963,564 V50E probably benign Het
Adamtsl1 C A 4: 86,385,628 H1342N possibly damaging Het
Adcy2 G T 13: 68,620,823 T1062K possibly damaging Het
Aqr T C 2: 114,113,327 N1110S probably damaging Het
Atp10a C T 7: 58,773,983 T232I probably damaging Het
Atp5f1 T A 3: 105,955,911 K70* probably null Het
Atp8b4 A C 2: 126,389,409 probably null Het
Atraid A C 5: 31,052,208 Q72P probably damaging Het
Atxn2 G T 5: 121,814,480 probably null Het
Best3 A T 10: 117,024,472 T546S probably benign Het
Brd3 T C 2: 27,463,948 K51E possibly damaging Het
Brip1 A G 11: 86,143,321 S525P possibly damaging Het
Ccdc109b A C 3: 129,916,997 F262C probably benign Het
Cenpf A G 1: 189,654,980 I1701T probably benign Het
Chrna9 A T 5: 65,971,084 K208* probably null Het
Clec2l T A 6: 38,680,192 C197S probably damaging Het
Crp A G 1: 172,698,519 H57R probably benign Het
Cyp27b1 C A 10: 127,052,095 T492N probably damaging Het
Dock4 A T 12: 40,676,742 I340F probably damaging Het
Dsg1b A T 18: 20,395,930 D241V probably damaging Het
Epg5 G T 18: 78,014,834 V1865L probably benign Het
Erap1 A G 13: 74,671,495 probably null Het
Fat2 C T 11: 55,253,832 C4072Y probably benign Het
Fat4 T A 3: 38,980,191 I2664N possibly damaging Het
Gabrp A G 11: 33,567,211 probably null Het
Glis2 G T 16: 4,614,082 probably benign Het
Gm11487 G T 4: 73,401,334 Q302K probably damaging Het
Gm17654 A G 14: 43,579,102 S15P probably damaging Het
Gm21836 A G 9: 124,493,753 V14A unknown Het
Gon7 G A 12: 102,754,121 T84I possibly damaging Het
Greb1 G T 12: 16,714,790 Y447* probably null Het
Grip2 A T 6: 91,779,831 D546E probably benign Het
Hectd1 A G 12: 51,802,533 probably null Het
Il1f6 T A 2: 24,224,474 F120L probably damaging Het
Itga4 T C 2: 79,320,576 V842A probably benign Het
Khsrp G A 17: 57,024,366 A404V probably benign Het
Map3k11 T C 19: 5,690,641 V132A probably damaging Het
Mysm1 A T 4: 94,948,377 V732E probably damaging Het
Npr2 T A 4: 43,640,673 probably null Het
Olfr101 T C 17: 37,300,051 I124V probably damaging Het
Olfr172 T C 16: 58,760,621 Y185C probably damaging Het
Olfr975 A C 9: 39,950,093 I226S probably damaging Het
Oxgr1 G T 14: 120,022,140 Y218* probably null Het
Paf1 A G 7: 28,395,972 Q161R possibly damaging Het
Pck1 A T 2: 173,156,085 K316* probably null Het
Plac8 T A 5: 100,556,505 M109L probably benign Het
Plagl2 A T 2: 153,232,319 C221S probably damaging Het
Polg T C 7: 79,454,098 D870G probably damaging Het
Polr2k T A 15: 36,174,997 M1K probably null Het
Prdm9 T C 17: 15,555,154 H276R probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Serpina3i A G 12: 104,265,655 I184V probably benign Het
Shank3 A G 15: 89,533,278 E26G possibly damaging Het
Skil T C 3: 31,117,451 S575P probably damaging Het
Slc13a1 A G 6: 24,108,159 L306P probably damaging Het
Slc20a1 G T 2: 129,200,509 W166L probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snrnp200 G T 2: 127,231,741 G1353V probably damaging Het
Sphkap A G 1: 83,280,503 I173T probably damaging Het
Stab2 A T 10: 86,907,197 F1183I probably damaging Het
Tank T A 2: 61,649,948 I276N probably benign Het
Tcaf3 A G 6: 42,591,467 W652R probably damaging Het
Tgm2 G A 2: 158,143,060 T42I possibly damaging Het
Tnni2 G T 7: 142,443,302 probably null Het
Tns1 A G 1: 73,953,612 S9P probably damaging Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Trdv2-1 T C 14: 53,946,406 S32P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Trpm3 T G 19: 22,697,454 Y72* probably null Het
Ube2o G A 11: 116,541,459 P894S possibly damaging Het
Ubr4 C T 4: 139,402,566 R666* probably null Het
Ugt1a8 T A 1: 88,088,123 L86* probably null Het
Usp32 T A 11: 85,022,259 N941I probably damaging Het
Utrn C T 10: 12,636,760 V2322M probably damaging Het
Vmn1r184 A T 7: 26,267,711 Y294F probably damaging Het
Vmn2r108 T C 17: 20,471,493 N256S probably benign Het
Wdr7 T C 18: 63,755,126 S557P probably damaging Het
Xrra1 C A 7: 99,898,483 P293Q possibly damaging Het
Zc3h18 A G 8: 122,383,649 D79G probably damaging Het
Zfp74 A T 7: 29,935,243 Y347N probably damaging Het
Zfp740 T C 15: 102,212,647 C169R possibly damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120679378 nonsense probably null
R7151:Stard9 UTSW 2 120696142 missense not run
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTGATTTCCAAAGACATCCAGG -3'
(R):5'- GAAAGATGGCTGATCCTCAAAGC -3'

Sequencing Primer
(F):5'- GAAGAGTTTAGTCTTCCAGGGACCC -3'
(R):5'- GGCTGATCCTCAAAGCATAAATG -3'
Posted On2016-07-22