Incidental Mutation 'R5213:Atp5f1'
ID403245
Institutional Source Beutler Lab
Gene Symbol Atp5f1
Ensembl Gene ENSMUSG00000000563
Gene NameATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1
SynonymsC76477
MMRRC Submission 042854-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5213 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location105942698-105960099 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 105955911 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 70 (K70*)
Ref Sequence ENSEMBL: ENSMUSP00000113022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010278] [ENSMUST00000118209] [ENSMUST00000130994] [ENSMUST00000133320]
Predicted Effect probably benign
Transcript: ENSMUST00000010278
SMART Domains Protein: ENSMUSP00000010278
Gene: ENSMUSG00000000561

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
WD40 70 107 5.11e1 SMART
WD40 115 153 1.06e-3 SMART
WD40 156 196 4.51e-7 SMART
WD40 201 241 2.75e1 SMART
WD40 244 284 9.94e-1 SMART
WD40 286 326 1.99e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118209
AA Change: K70*
SMART Domains Protein: ENSMUSP00000113022
Gene: ENSMUSG00000000563
AA Change: K70*

DomainStartEndE-ValueType
Pfam:Mt_ATP-synt_B 83 244 2.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127464
Predicted Effect probably benign
Transcript: ENSMUST00000130994
SMART Domains Protein: ENSMUSP00000120517
Gene: ENSMUSG00000000561

DomainStartEndE-ValueType
PDB:4GQB|B 1 52 8e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167642
Predicted Effect probably benign
Transcript: ENSMUST00000199311
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the b subunit of the proton channel. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,326,053 P199Q possibly damaging Het
4430402I18Rik A T 19: 28,963,564 V50E probably benign Het
Adamtsl1 C A 4: 86,385,628 H1342N possibly damaging Het
Adcy2 G T 13: 68,620,823 T1062K possibly damaging Het
Aqr T C 2: 114,113,327 N1110S probably damaging Het
Atp10a C T 7: 58,773,983 T232I probably damaging Het
Atp8b4 A C 2: 126,389,409 probably null Het
Atraid A C 5: 31,052,208 Q72P probably damaging Het
Atxn2 G T 5: 121,814,480 probably null Het
Best3 A T 10: 117,024,472 T546S probably benign Het
Brd3 T C 2: 27,463,948 K51E possibly damaging Het
Brip1 A G 11: 86,143,321 S525P possibly damaging Het
Ccdc109b A C 3: 129,916,997 F262C probably benign Het
Cenpf A G 1: 189,654,980 I1701T probably benign Het
Chrna9 A T 5: 65,971,084 K208* probably null Het
Clec2l T A 6: 38,680,192 C197S probably damaging Het
Crp A G 1: 172,698,519 H57R probably benign Het
Cyp27b1 C A 10: 127,052,095 T492N probably damaging Het
Dock4 A T 12: 40,676,742 I340F probably damaging Het
Dsg1b A T 18: 20,395,930 D241V probably damaging Het
Epg5 G T 18: 78,014,834 V1865L probably benign Het
Erap1 A G 13: 74,671,495 probably null Het
Fat2 C T 11: 55,253,832 C4072Y probably benign Het
Fat4 T A 3: 38,980,191 I2664N possibly damaging Het
Gabrp A G 11: 33,567,211 probably null Het
Glis2 G T 16: 4,614,082 probably benign Het
Gm11487 G T 4: 73,401,334 Q302K probably damaging Het
Gm17654 A G 14: 43,579,102 S15P probably damaging Het
Gm21836 A G 9: 124,493,753 V14A unknown Het
Gon7 G A 12: 102,754,121 T84I possibly damaging Het
Greb1 G T 12: 16,714,790 Y447* probably null Het
Grip2 A T 6: 91,779,831 D546E probably benign Het
Hectd1 A G 12: 51,802,533 probably null Het
Il1f6 T A 2: 24,224,474 F120L probably damaging Het
Itga4 T C 2: 79,320,576 V842A probably benign Het
Khsrp G A 17: 57,024,366 A404V probably benign Het
Map3k11 T C 19: 5,690,641 V132A probably damaging Het
Mysm1 A T 4: 94,948,377 V732E probably damaging Het
Npr2 T A 4: 43,640,673 probably null Het
Olfr101 T C 17: 37,300,051 I124V probably damaging Het
Olfr172 T C 16: 58,760,621 Y185C probably damaging Het
Olfr975 A C 9: 39,950,093 I226S probably damaging Het
Oxgr1 G T 14: 120,022,140 Y218* probably null Het
Paf1 A G 7: 28,395,972 Q161R possibly damaging Het
Pck1 A T 2: 173,156,085 K316* probably null Het
Plac8 T A 5: 100,556,505 M109L probably benign Het
Plagl2 A T 2: 153,232,319 C221S probably damaging Het
Polg T C 7: 79,454,098 D870G probably damaging Het
Polr2k T A 15: 36,174,997 M1K probably null Het
Prdm9 T C 17: 15,555,154 H276R probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Serpina3i A G 12: 104,265,655 I184V probably benign Het
Shank3 A G 15: 89,533,278 E26G possibly damaging Het
Skil T C 3: 31,117,451 S575P probably damaging Het
Slc13a1 A G 6: 24,108,159 L306P probably damaging Het
Slc20a1 G T 2: 129,200,509 W166L probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snrnp200 G T 2: 127,231,741 G1353V probably damaging Het
Sphkap A G 1: 83,280,503 I173T probably damaging Het
Stab2 A T 10: 86,907,197 F1183I probably damaging Het
Stard9 A G 2: 120,699,226 D1988G probably damaging Het
Tank T A 2: 61,649,948 I276N probably benign Het
Tcaf3 A G 6: 42,591,467 W652R probably damaging Het
Tgm2 G A 2: 158,143,060 T42I possibly damaging Het
Tnni2 G T 7: 142,443,302 probably null Het
Tns1 A G 1: 73,953,612 S9P probably damaging Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Trdv2-1 T C 14: 53,946,406 S32P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Trpm3 T G 19: 22,697,454 Y72* probably null Het
Ube2o G A 11: 116,541,459 P894S possibly damaging Het
Ubr4 C T 4: 139,402,566 R666* probably null Het
Ugt1a8 T A 1: 88,088,123 L86* probably null Het
Usp32 T A 11: 85,022,259 N941I probably damaging Het
Utrn C T 10: 12,636,760 V2322M probably damaging Het
Vmn1r184 A T 7: 26,267,711 Y294F probably damaging Het
Vmn2r108 T C 17: 20,471,493 N256S probably benign Het
Wdr7 T C 18: 63,755,126 S557P probably damaging Het
Xrra1 C A 7: 99,898,483 P293Q possibly damaging Het
Zc3h18 A G 8: 122,383,649 D79G probably damaging Het
Zfp74 A T 7: 29,935,243 Y347N probably damaging Het
Zfp740 T C 15: 102,212,647 C169R possibly damaging Het
Other mutations in Atp5f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1018:Atp5f1 UTSW 3 105954172 missense possibly damaging 0.77
R1763:Atp5f1 UTSW 3 105951589 critical splice donor site probably null
R2045:Atp5f1 UTSW 3 105943874 intron probably benign
R7051:Atp5f1 UTSW 3 105943767 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TAGAACAATGCCTGGCAGTAAAC -3'
(R):5'- GGAAACTCCTCAGTCTCCATC -3'

Sequencing Primer
(F):5'- TGCCTGGCAGTAAACCAAAG -3'
(R):5'- ATCTCCCTTCATGGTTTTGTTAATTG -3'
Posted On2016-07-22