Incidental Mutation 'R5213:Atxn2'
ID403257
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Nameataxin 2
Synonyms9630045M23Rik, ATX2, Sca2
MMRRC Submission 042854-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R5213 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121711337-121816493 bp(+) (GRCm38)
Type of Mutationunclassified (5 bp from exon)
DNA Base Change (assembly) G to T at 121814480 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000040308] [ENSMUST00000051950] [ENSMUST00000086310] [ENSMUST00000118580] [ENSMUST00000122426] [ENSMUST00000136960] [ENSMUST00000160220] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327] [ENSMUST00000197892]
Predicted Effect probably benign
Transcript: ENSMUST00000040308
SMART Domains Protein: ENSMUSP00000041611
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 23 76 1.1e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051950
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086310
SMART Domains Protein: ENSMUSP00000083490
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118580
SMART Domains Protein: ENSMUSP00000113808
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 4.1e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 324 409 3.53e-19 SMART
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122426
SMART Domains Protein: ENSMUSP00000113926
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136960
SMART Domains Protein: ENSMUSP00000119086
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2.4e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect probably benign
Transcript: ENSMUST00000160220
SMART Domains Protein: ENSMUSP00000124059
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161159
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161836
Predicted Effect probably benign
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162459
Predicted Effect probably null
Transcript: ENSMUST00000162995
SMART Domains Protein: ENSMUSP00000124403
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 88 125 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 202 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183860
Predicted Effect probably benign
Transcript: ENSMUST00000197892
SMART Domains Protein: ENSMUSP00000142666
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 6.3e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
Blast:PH 168 250 3e-53 BLAST
PDB:1V5M|A 171 250 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000198161
Predicted Effect probably benign
Transcript: ENSMUST00000199864
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,326,053 P199Q possibly damaging Het
4430402I18Rik A T 19: 28,963,564 V50E probably benign Het
Adamtsl1 C A 4: 86,385,628 H1342N possibly damaging Het
Adcy2 G T 13: 68,620,823 T1062K possibly damaging Het
Aqr T C 2: 114,113,327 N1110S probably damaging Het
Atp10a C T 7: 58,773,983 T232I probably damaging Het
Atp5f1 T A 3: 105,955,911 K70* probably null Het
Atp8b4 A C 2: 126,389,409 probably null Het
Atraid A C 5: 31,052,208 Q72P probably damaging Het
Best3 A T 10: 117,024,472 T546S probably benign Het
Brd3 T C 2: 27,463,948 K51E possibly damaging Het
Brip1 A G 11: 86,143,321 S525P possibly damaging Het
Ccdc109b A C 3: 129,916,997 F262C probably benign Het
Cenpf A G 1: 189,654,980 I1701T probably benign Het
Chrna9 A T 5: 65,971,084 K208* probably null Het
Clec2l T A 6: 38,680,192 C197S probably damaging Het
Crp A G 1: 172,698,519 H57R probably benign Het
Cyp27b1 C A 10: 127,052,095 T492N probably damaging Het
Dock4 A T 12: 40,676,742 I340F probably damaging Het
Dsg1b A T 18: 20,395,930 D241V probably damaging Het
Epg5 G T 18: 78,014,834 V1865L probably benign Het
Erap1 A G 13: 74,671,495 probably null Het
Fat2 C T 11: 55,253,832 C4072Y probably benign Het
Fat4 T A 3: 38,980,191 I2664N possibly damaging Het
Gabrp A G 11: 33,567,211 probably null Het
Glis2 G T 16: 4,614,082 probably benign Het
Gm11487 G T 4: 73,401,334 Q302K probably damaging Het
Gm17654 A G 14: 43,579,102 S15P probably damaging Het
Gm21836 A G 9: 124,493,753 V14A unknown Het
Gon7 G A 12: 102,754,121 T84I possibly damaging Het
Greb1 G T 12: 16,714,790 Y447* probably null Het
Grip2 A T 6: 91,779,831 D546E probably benign Het
Hectd1 A G 12: 51,802,533 probably null Het
Il1f6 T A 2: 24,224,474 F120L probably damaging Het
Itga4 T C 2: 79,320,576 V842A probably benign Het
Khsrp G A 17: 57,024,366 A404V probably benign Het
Map3k11 T C 19: 5,690,641 V132A probably damaging Het
Mysm1 A T 4: 94,948,377 V732E probably damaging Het
Npr2 T A 4: 43,640,673 probably null Het
Olfr101 T C 17: 37,300,051 I124V probably damaging Het
Olfr172 T C 16: 58,760,621 Y185C probably damaging Het
Olfr975 A C 9: 39,950,093 I226S probably damaging Het
Oxgr1 G T 14: 120,022,140 Y218* probably null Het
Paf1 A G 7: 28,395,972 Q161R possibly damaging Het
Pck1 A T 2: 173,156,085 K316* probably null Het
Plac8 T A 5: 100,556,505 M109L probably benign Het
Plagl2 A T 2: 153,232,319 C221S probably damaging Het
Polg T C 7: 79,454,098 D870G probably damaging Het
Polr2k T A 15: 36,174,997 M1K probably null Het
Prdm9 T C 17: 15,555,154 H276R probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Serpina3i A G 12: 104,265,655 I184V probably benign Het
Shank3 A G 15: 89,533,278 E26G possibly damaging Het
Skil T C 3: 31,117,451 S575P probably damaging Het
Slc13a1 A G 6: 24,108,159 L306P probably damaging Het
Slc20a1 G T 2: 129,200,509 W166L probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snrnp200 G T 2: 127,231,741 G1353V probably damaging Het
Sphkap A G 1: 83,280,503 I173T probably damaging Het
Stab2 A T 10: 86,907,197 F1183I probably damaging Het
Stard9 A G 2: 120,699,226 D1988G probably damaging Het
Tank T A 2: 61,649,948 I276N probably benign Het
Tcaf3 A G 6: 42,591,467 W652R probably damaging Het
Tgm2 G A 2: 158,143,060 T42I possibly damaging Het
Tnni2 G T 7: 142,443,302 probably null Het
Tns1 A G 1: 73,953,612 S9P probably damaging Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Trdv2-1 T C 14: 53,946,406 S32P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Trpm3 T G 19: 22,697,454 Y72* probably null Het
Ube2o G A 11: 116,541,459 P894S possibly damaging Het
Ubr4 C T 4: 139,402,566 R666* probably null Het
Ugt1a8 T A 1: 88,088,123 L86* probably null Het
Usp32 T A 11: 85,022,259 N941I probably damaging Het
Utrn C T 10: 12,636,760 V2322M probably damaging Het
Vmn1r184 A T 7: 26,267,711 Y294F probably damaging Het
Vmn2r108 T C 17: 20,471,493 N256S probably benign Het
Wdr7 T C 18: 63,755,126 S557P probably damaging Het
Xrra1 C A 7: 99,898,483 P293Q possibly damaging Het
Zc3h18 A G 8: 122,383,649 D79G probably damaging Het
Zfp74 A T 7: 29,935,243 Y347N probably damaging Het
Zfp740 T C 15: 102,212,647 C169R possibly damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121795055 missense probably benign 0.00
IGL00798:Atxn2 APN 5 121795235 missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121810979 missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121797344 missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121806268 nonsense probably null
IGL02122:Atxn2 APN 5 121778030 missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121781387 missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121781336 missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121810909 missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121785235 missense probably benign 0.00
R0387:Atxn2 UTSW 5 121802143 missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121772778 missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121747421 unclassified probably null
R1305:Atxn2 UTSW 5 121749184 missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121803082 critical splice donor site probably null
R1471:Atxn2 UTSW 5 121786374 missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121779591 missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121802108 missense probably damaging 0.99
R1528:Atxn2 UTSW 5 121813530 missense probably damaging 1.00
R2083:Atxn2 UTSW 5 121784006 missense probably benign 0.00
R2197:Atxn2 UTSW 5 121806217 splice site probably null
R2217:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121781393 missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121785868 critical splice donor site probably null
R4604:Atxn2 UTSW 5 121781343 missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121814411 missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121749096 missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121814343 missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121795035 unclassified probably null
R5655:Atxn2 UTSW 5 121747426 missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121813449 missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121797310 missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121810992 missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121779432 missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121811614 critical splice donor site probably null
R6659:Atxn2 UTSW 5 121777964 missense probably benign 0.10
R6864:Atxn2 UTSW 5 121779494 missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121811467 nonsense probably null
X0028:Atxn2 UTSW 5 121802083 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTGACAGTCGTGTGCTGC -3'
(R):5'- GTTCATGACTCTCAAGGGCC -3'

Sequencing Primer
(F):5'- TGCCTGTGTTGTTTAAATAGCCAC -3'
(R):5'- ATGGAACAGCCACAAGTC -3'
Posted On2016-07-22