Incidental Mutation 'R5213:Greb1'
ID403286
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission 042854-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5213 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 16714790 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 447 (Y447*)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably null
Transcript: ENSMUST00000048064
AA Change: Y447*
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: Y447*

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159120
AA Change: Y447*
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: Y447*

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160627
SMART Domains Protein: ENSMUSP00000124922
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 122 1.8e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect probably null
Transcript: ENSMUST00000162112
AA Change: Y447*
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: Y447*

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,326,053 P199Q possibly damaging Het
4430402I18Rik A T 19: 28,963,564 V50E probably benign Het
Adamtsl1 C A 4: 86,385,628 H1342N possibly damaging Het
Adcy2 G T 13: 68,620,823 T1062K possibly damaging Het
Aqr T C 2: 114,113,327 N1110S probably damaging Het
Atp10a C T 7: 58,773,983 T232I probably damaging Het
Atp5f1 T A 3: 105,955,911 K70* probably null Het
Atp8b4 A C 2: 126,389,409 probably null Het
Atraid A C 5: 31,052,208 Q72P probably damaging Het
Atxn2 G T 5: 121,814,480 probably null Het
Best3 A T 10: 117,024,472 T546S probably benign Het
Brd3 T C 2: 27,463,948 K51E possibly damaging Het
Brip1 A G 11: 86,143,321 S525P possibly damaging Het
Ccdc109b A C 3: 129,916,997 F262C probably benign Het
Cenpf A G 1: 189,654,980 I1701T probably benign Het
Chrna9 A T 5: 65,971,084 K208* probably null Het
Clec2l T A 6: 38,680,192 C197S probably damaging Het
Crp A G 1: 172,698,519 H57R probably benign Het
Cyp27b1 C A 10: 127,052,095 T492N probably damaging Het
Dock4 A T 12: 40,676,742 I340F probably damaging Het
Dsg1b A T 18: 20,395,930 D241V probably damaging Het
Epg5 G T 18: 78,014,834 V1865L probably benign Het
Erap1 A G 13: 74,671,495 probably null Het
Fat2 C T 11: 55,253,832 C4072Y probably benign Het
Fat4 T A 3: 38,980,191 I2664N possibly damaging Het
Gabrp A G 11: 33,567,211 probably null Het
Glis2 G T 16: 4,614,082 probably benign Het
Gm11487 G T 4: 73,401,334 Q302K probably damaging Het
Gm17654 A G 14: 43,579,102 S15P probably damaging Het
Gm21836 A G 9: 124,493,753 V14A unknown Het
Gon7 G A 12: 102,754,121 T84I possibly damaging Het
Grip2 A T 6: 91,779,831 D546E probably benign Het
Hectd1 A G 12: 51,802,533 probably null Het
Il1f6 T A 2: 24,224,474 F120L probably damaging Het
Itga4 T C 2: 79,320,576 V842A probably benign Het
Khsrp G A 17: 57,024,366 A404V probably benign Het
Map3k11 T C 19: 5,690,641 V132A probably damaging Het
Mysm1 A T 4: 94,948,377 V732E probably damaging Het
Npr2 T A 4: 43,640,673 probably null Het
Olfr101 T C 17: 37,300,051 I124V probably damaging Het
Olfr172 T C 16: 58,760,621 Y185C probably damaging Het
Olfr975 A C 9: 39,950,093 I226S probably damaging Het
Oxgr1 G T 14: 120,022,140 Y218* probably null Het
Paf1 A G 7: 28,395,972 Q161R possibly damaging Het
Pck1 A T 2: 173,156,085 K316* probably null Het
Plac8 T A 5: 100,556,505 M109L probably benign Het
Plagl2 A T 2: 153,232,319 C221S probably damaging Het
Polg T C 7: 79,454,098 D870G probably damaging Het
Polr2k T A 15: 36,174,997 M1K probably null Het
Prdm9 T C 17: 15,555,154 H276R probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Serpina3i A G 12: 104,265,655 I184V probably benign Het
Shank3 A G 15: 89,533,278 E26G possibly damaging Het
Skil T C 3: 31,117,451 S575P probably damaging Het
Slc13a1 A G 6: 24,108,159 L306P probably damaging Het
Slc20a1 G T 2: 129,200,509 W166L probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Snrnp200 G T 2: 127,231,741 G1353V probably damaging Het
Sphkap A G 1: 83,280,503 I173T probably damaging Het
Stab2 A T 10: 86,907,197 F1183I probably damaging Het
Stard9 A G 2: 120,699,226 D1988G probably damaging Het
Tank T A 2: 61,649,948 I276N probably benign Het
Tcaf3 A G 6: 42,591,467 W652R probably damaging Het
Tgm2 G A 2: 158,143,060 T42I possibly damaging Het
Tnni2 G T 7: 142,443,302 probably null Het
Tns1 A G 1: 73,953,612 S9P probably damaging Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Trdv2-1 T C 14: 53,946,406 S32P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Trpm3 T G 19: 22,697,454 Y72* probably null Het
Ube2o G A 11: 116,541,459 P894S possibly damaging Het
Ubr4 C T 4: 139,402,566 R666* probably null Het
Ugt1a8 T A 1: 88,088,123 L86* probably null Het
Usp32 T A 11: 85,022,259 N941I probably damaging Het
Utrn C T 10: 12,636,760 V2322M probably damaging Het
Vmn1r184 A T 7: 26,267,711 Y294F probably damaging Het
Vmn2r108 T C 17: 20,471,493 N256S probably benign Het
Wdr7 T C 18: 63,755,126 S557P probably damaging Het
Xrra1 C A 7: 99,898,483 P293Q possibly damaging Het
Zc3h18 A G 8: 122,383,649 D79G probably damaging Het
Zfp74 A T 7: 29,935,243 Y347N probably damaging Het
Zfp740 T C 15: 102,212,647 C169R possibly damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGTGAGTGAACAGTCTCTG -3'
(R):5'- GAGCACAAGACCAGTTGCTG -3'

Sequencing Primer
(F):5'- GTGAACAGTCTCTGAACCACTCTG -3'
(R):5'- CACAAGACCAGTTGCTGAATTG -3'
Posted On2016-07-22