Incidental Mutation 'R5214:Tecta'
ID403351
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
MMRRC Submission 042787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5214 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42345668 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1571 (V1571I)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably benign
Transcript: ENSMUST00000042190
AA Change: V1571I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: V1571I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159603
Predicted Effect probably benign
Transcript: ENSMUST00000160940
AA Change: V1571I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: V1571I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,886,493 V613A probably benign Het
1700061I17Rik A G 3: 117,067,775 noncoding transcript Het
4930449A18Rik A T 3: 59,825,884 noncoding transcript Het
Adgrl1 G A 8: 83,915,573 probably null Het
Aldh1l1 A G 6: 90,563,417 D228G probably damaging Het
Ankrd17 T C 5: 90,283,460 I822V possibly damaging Het
Atm C A 9: 53,491,027 A1382S probably benign Het
Cacna1e T A 1: 154,701,364 I96F possibly damaging Het
Ccar1 G A 10: 62,770,961 R335C probably damaging Het
Ccdc113 T C 8: 95,545,973 I236T possibly damaging Het
Ccdc14 T A 16: 34,704,855 S125T probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdon T C 9: 35,483,208 C917R probably damaging Het
Ckap2l T C 2: 129,285,469 D263G probably benign Het
Cntnap3 G T 13: 64,762,010 H760Q probably damaging Het
Dennd2d G A 3: 106,486,321 probably null Het
Dock4 A G 12: 40,704,466 I485V probably benign Het
Dspp A G 5: 104,178,498 D909G unknown Het
Eps8 A T 6: 137,527,492 M81K probably damaging Het
Fam26e A G 10: 34,092,491 S189P probably damaging Het
Fras1 T C 5: 96,769,593 S3491P probably damaging Het
Gm12569 C A 11: 51,234,848 H199Q possibly damaging Het
Gm17669 C T 18: 67,562,409 T8I possibly damaging Het
Gm5114 G T 7: 39,408,368 T609K probably benign Het
Gm973 A G 1: 59,526,721 N32S probably damaging Het
Herpud1 G T 8: 94,390,851 probably null Het
Jcad T A 18: 4,674,134 L632Q probably damaging Het
Kcnh8 T C 17: 52,898,458 L527S probably damaging Het
Klk1b11 C A 7: 43,997,842 H67N probably benign Het
Ldhb T A 6: 142,495,595 I190F probably damaging Het
Lrrc34 A T 3: 30,636,248 C168* probably null Het
Lrtm1 C T 14: 29,021,694 H40Y possibly damaging Het
Mageb3 T C 2: 121,954,838 M128V possibly damaging Het
Miga2 A G 2: 30,371,196 T90A probably benign Het
Ndrg1 G A 15: 66,959,390 T24I probably damaging Het
Nos2 T C 11: 78,955,441 L878P probably damaging Het
Olfr743 T G 14: 50,534,347 *312E probably null Het
Pcdhgb1 T A 18: 37,681,425 I323N probably damaging Het
Plec A G 15: 76,177,721 I2537T probably damaging Het
Pnpo C A 11: 96,942,469 E68D probably benign Het
Ppp6r1 C T 7: 4,643,177 R175Q probably benign Het
Prnp C T 2: 131,937,004 T192I probably damaging Het
Ptprb T C 10: 116,369,324 I2148T possibly damaging Het
Raf1 G T 6: 115,637,622 F99L possibly damaging Het
Rbks A G 5: 31,650,392 probably benign Het
Rlf T C 4: 121,150,700 D361G probably damaging Het
Rnpepl1 G T 1: 92,919,279 D608Y probably benign Het
Scaf1 G A 7: 45,003,238 probably benign Het
Sh3rf1 A T 8: 61,372,731 M587L probably damaging Het
Slc22a21 A T 11: 53,953,043 S473T probably damaging Het
Syt15 A G 14: 34,221,746 D84G possibly damaging Het
Tbc1d19 T C 5: 53,849,841 L236P probably benign Het
Tbx2 G T 11: 85,838,437 A549S probably benign Het
Tc2n A T 12: 101,693,202 C157* probably null Het
Them4 A G 3: 94,317,511 K65R probably benign Het
Tmc5 C T 7: 118,647,932 T553M probably damaging Het
Tmem200c C T 17: 68,841,127 A235V probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tmf1 G C 6: 97,167,292 A701G possibly damaging Het
Tomm70a G A 16: 57,121,937 G26S unknown Het
Treh T C 9: 44,682,876 Y140H probably damaging Het
Ttc28 A G 5: 111,177,623 probably benign Het
Uba7 T C 9: 107,977,514 probably benign Het
Ube4a T C 9: 44,948,868 I299V probably benign Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Zfhx4 A C 3: 5,403,641 K2953T probably damaging Het
Zfp280d T A 9: 72,308,113 probably benign Het
Zscan20 G A 4: 128,588,316 R518C probably benign Het
Zw10 T C 9: 49,064,163 I296T possibly damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAAGTTCCCACAGAGCC -3'
(R):5'- ACCCACATGCTGTGTCTGTG -3'

Sequencing Primer
(F):5'- AGAGCCCACACACTTTGTTCTGTAG -3'
(R):5'- CTAGCCTGGTACTTGATAACTAGGC -3'
Posted On2016-07-22