Incidental Mutation 'R5214:Ccar1'
ID403359
Institutional Source Beutler Lab
Gene Symbol Ccar1
Ensembl Gene ENSMUSG00000020074
Gene Namecell division cycle and apoptosis regulator 1
Synonyms9430036H15Rik, Carp1, 2610511G16Rik
MMRRC Submission 042787-MU
Accession Numbers

Genbank: NM_026201.3; Ensembl: ENSMUST00000020268

Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R5214 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62743928-62792286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62770961 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 335 (R335C)
Ref Sequence ENSEMBL: ENSMUSP00000151895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020268] [ENSMUST00000219527]
Predicted Effect probably damaging
Transcript: ENSMUST00000020268
AA Change: R335C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020268
Gene: ENSMUSG00000020074
AA Change: R335C

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 62 106 N/A INTRINSIC
Pfam:S1-like 144 201 1.7e-34 PFAM
low complexity region 236 254 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 358 N/A INTRINSIC
DBC1 475 606 4.46e-90 SMART
SAP 633 667 5.25e-9 SMART
Blast:HDc 753 784 1e-7 BLAST
coiled coil region 792 819 N/A INTRINSIC
low complexity region 871 895 N/A INTRINSIC
SCOP:d1hqva_ 898 964 5e-3 SMART
Blast:HDc 921 979 5e-17 BLAST
coiled coil region 1029 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219441
Predicted Effect probably damaging
Transcript: ENSMUST00000219527
AA Change: R335C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (77/77)
Allele List at MGI

All alleles(45) : Targeted, other(4) Gene trapped(41)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,886,493 V613A probably benign Het
1700061I17Rik A G 3: 117,067,775 noncoding transcript Het
4930449A18Rik A T 3: 59,825,884 noncoding transcript Het
Adgrl1 G A 8: 83,915,573 probably null Het
Aldh1l1 A G 6: 90,563,417 D228G probably damaging Het
Ankrd17 T C 5: 90,283,460 I822V possibly damaging Het
Atm C A 9: 53,491,027 A1382S probably benign Het
Cacna1e T A 1: 154,701,364 I96F possibly damaging Het
Ccdc113 T C 8: 95,545,973 I236T possibly damaging Het
Ccdc14 T A 16: 34,704,855 S125T probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdon T C 9: 35,483,208 C917R probably damaging Het
Ckap2l T C 2: 129,285,469 D263G probably benign Het
Cntnap3 G T 13: 64,762,010 H760Q probably damaging Het
Dennd2d G A 3: 106,486,321 probably null Het
Dock4 A G 12: 40,704,466 I485V probably benign Het
Dspp A G 5: 104,178,498 D909G unknown Het
Eps8 A T 6: 137,527,492 M81K probably damaging Het
Fam26e A G 10: 34,092,491 S189P probably damaging Het
Fras1 T C 5: 96,769,593 S3491P probably damaging Het
Gm12569 C A 11: 51,234,848 H199Q possibly damaging Het
Gm17669 C T 18: 67,562,409 T8I possibly damaging Het
Gm5114 G T 7: 39,408,368 T609K probably benign Het
Gm973 A G 1: 59,526,721 N32S probably damaging Het
Herpud1 G T 8: 94,390,851 probably null Het
Jcad T A 18: 4,674,134 L632Q probably damaging Het
Kcnh8 T C 17: 52,898,458 L527S probably damaging Het
Klk1b11 C A 7: 43,997,842 H67N probably benign Het
Ldhb T A 6: 142,495,595 I190F probably damaging Het
Lrrc34 A T 3: 30,636,248 C168* probably null Het
Lrtm1 C T 14: 29,021,694 H40Y possibly damaging Het
Mageb3 T C 2: 121,954,838 M128V possibly damaging Het
Miga2 A G 2: 30,371,196 T90A probably benign Het
Ndrg1 G A 15: 66,959,390 T24I probably damaging Het
Nos2 T C 11: 78,955,441 L878P probably damaging Het
Olfr743 T G 14: 50,534,347 *312E probably null Het
Pcdhgb1 T A 18: 37,681,425 I323N probably damaging Het
Plec A G 15: 76,177,721 I2537T probably damaging Het
Pnpo C A 11: 96,942,469 E68D probably benign Het
Ppp6r1 C T 7: 4,643,177 R175Q probably benign Het
Prnp C T 2: 131,937,004 T192I probably damaging Het
Ptprb T C 10: 116,369,324 I2148T possibly damaging Het
Raf1 G T 6: 115,637,622 F99L possibly damaging Het
Rbks A G 5: 31,650,392 probably benign Het
Rlf T C 4: 121,150,700 D361G probably damaging Het
Rnpepl1 G T 1: 92,919,279 D608Y probably benign Het
Scaf1 G A 7: 45,003,238 probably benign Het
Sh3rf1 A T 8: 61,372,731 M587L probably damaging Het
Slc22a21 A T 11: 53,953,043 S473T probably damaging Het
Syt15 A G 14: 34,221,746 D84G possibly damaging Het
Tbc1d19 T C 5: 53,849,841 L236P probably benign Het
Tbx2 G T 11: 85,838,437 A549S probably benign Het
Tc2n A T 12: 101,693,202 C157* probably null Het
Tecta C T 9: 42,345,668 V1571I probably benign Het
Them4 A G 3: 94,317,511 K65R probably benign Het
Tmc5 C T 7: 118,647,932 T553M probably damaging Het
Tmem200c C T 17: 68,841,127 A235V probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tmf1 G C 6: 97,167,292 A701G possibly damaging Het
Tomm70a G A 16: 57,121,937 G26S unknown Het
Treh T C 9: 44,682,876 Y140H probably damaging Het
Ttc28 A G 5: 111,177,623 probably benign Het
Uba7 T C 9: 107,977,514 probably benign Het
Ube4a T C 9: 44,948,868 I299V probably benign Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Zfhx4 A C 3: 5,403,641 K2953T probably damaging Het
Zfp280d T A 9: 72,308,113 probably benign Het
Zscan20 G A 4: 128,588,316 R518C probably benign Het
Zw10 T C 9: 49,064,163 I296T possibly damaging Het
Other mutations in Ccar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Ccar1 APN 10 62753234 missense unknown
IGL01291:Ccar1 APN 10 62756649 missense probably damaging 1.00
IGL01364:Ccar1 APN 10 62776874 unclassified probably null
IGL01777:Ccar1 APN 10 62780577 missense possibly damaging 0.71
IGL01958:Ccar1 APN 10 62790935 missense possibly damaging 0.94
IGL03096:Ccar1 APN 10 62764333 missense probably benign 0.20
Lonk UTSW 10 62764533 missense probably damaging 1.00
1mM(1):Ccar1 UTSW 10 62783886 missense probably benign 0.00
ANU05:Ccar1 UTSW 10 62756649 missense probably damaging 1.00
R0440:Ccar1 UTSW 10 62780457 missense possibly damaging 0.94
R1295:Ccar1 UTSW 10 62783882 critical splice donor site probably null
R1573:Ccar1 UTSW 10 62750655 missense unknown
R1585:Ccar1 UTSW 10 62751001 missense unknown
R1633:Ccar1 UTSW 10 62751014 missense unknown
R1840:Ccar1 UTSW 10 62763510 missense probably damaging 0.98
R1854:Ccar1 UTSW 10 62764517 missense probably damaging 1.00
R1905:Ccar1 UTSW 10 62776658 missense possibly damaging 0.85
R2011:Ccar1 UTSW 10 62776694 missense probably benign 0.03
R2041:Ccar1 UTSW 10 62766048 missense probably damaging 1.00
R2202:Ccar1 UTSW 10 62745287 missense unknown
R2327:Ccar1 UTSW 10 62764382 missense probably damaging 1.00
R2932:Ccar1 UTSW 10 62776759 missense probably benign 0.08
R3040:Ccar1 UTSW 10 62756494 missense possibly damaging 0.83
R4647:Ccar1 UTSW 10 62747417 nonsense probably null
R4829:Ccar1 UTSW 10 62745335 missense unknown
R4887:Ccar1 UTSW 10 62753218 missense unknown
R4888:Ccar1 UTSW 10 62753218 missense unknown
R5000:Ccar1 UTSW 10 62751005 missense unknown
R5207:Ccar1 UTSW 10 62753281 missense unknown
R5644:Ccar1 UTSW 10 62771978 missense probably benign 0.16
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6063:Ccar1 UTSW 10 62776717 missense possibly damaging 0.70
R6330:Ccar1 UTSW 10 62764533 missense probably damaging 1.00
R6370:Ccar1 UTSW 10 62764529 missense probably damaging 1.00
R6828:Ccar1 UTSW 10 62764430 missense probably damaging 0.98
R6943:Ccar1 UTSW 10 62746936 missense unknown
V8831:Ccar1 UTSW 10 62747406 missense unknown
X0017:Ccar1 UTSW 10 62765340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTTCCACCCTCAAATAAATAGCT -3'
(R):5'- TATACACATACAAAGTCTGGCAAAA -3'

Sequencing Primer
(F):5'- ACCCTCAAATAAATAGCTCAAACTG -3'
(R):5'- GTCTAACTACATAGGCTTGGACCG -3'
Posted On2016-07-22