Incidental Mutation 'R0416:Dnah11'
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Namedynein, axonemal, heavy chain 11
Synonymsb2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R0416 (G1)
Quality Score225
Status Validated
Chromosomal Location117877982-118199043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117911058 bp
Amino Acid Change Methionine to Lysine at position 4024 (M4024K)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
Predicted Effect probably damaging
Transcript: ENSMUST00000084806
AA Change: M4024K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: M4024K

low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176239
Predicted Effect probably benign
Transcript: ENSMUST00000176756
Meta Mutation Damage Score 0.542 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Robo4 T C 9: 37,404,766 probably benign Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118198745 missense probably benign 0.28
IGL00422:Dnah11 APN 12 118068096 missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118036459 missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118186922 missense probably benign 0.01
IGL00687:Dnah11 APN 12 117922004 splice site probably benign
IGL00833:Dnah11 APN 12 118179580 missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117911202 missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118196651 missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118142934 splice site probably benign
IGL01121:Dnah11 APN 12 118050695 missense probably benign 0.02
IGL01143:Dnah11 APN 12 118012740 missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117982999 missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118192399 missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118047256 nonsense probably null
IGL01418:Dnah11 APN 12 117987482 nonsense probably null
IGL01444:Dnah11 APN 12 118020232 missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117983032 missense probably benign 0.15
IGL01645:Dnah11 APN 12 118186998 missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118192270 splice site probably benign
IGL02104:Dnah11 APN 12 118192390 missense probably benign
IGL02151:Dnah11 APN 12 118059888 splice site probably benign
IGL02189:Dnah11 APN 12 118082579 missense probably benign 0.00
IGL02417:Dnah11 APN 12 118057180 missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118186902 missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117975873 splice site probably benign
IGL02474:Dnah11 APN 12 118027445 splice site probably null
IGL02526:Dnah11 APN 12 118179618 missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117911040 missense probably damaging 1.00
IGL03011:Dnah11 APN 12 118012377 missense probably benign 0.08
IGL03061:Dnah11 APN 12 117903121 missense probably damaging 1.00
IGL03182:Dnah11 APN 12 118030291 missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118105985 missense probably benign
IGL03238:Dnah11 APN 12 118109898 missense probably damaging 1.00
IGL03493:Dnah11 APN 12 118012798 missense probably benign 0.00
P0045:Dnah11 UTSW 12 118030327 missense probably benign
R0009:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118126886 missense probably benign 0.05
R0172:Dnah11 UTSW 12 117987453 missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117983056 nonsense probably null
R0270:Dnah11 UTSW 12 118041013 missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118127133 missense probably benign 0.03
R0325:Dnah11 UTSW 12 118012339 missense probably benign
R0370:Dnah11 UTSW 12 117995227 missense probably benign
R0505:Dnah11 UTSW 12 118106510 missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117931178 missense probably benign 0.01
R0607:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117987469 missense probably damaging 1.00
R0635:Dnah11 UTSW 12 118007996 missense probably damaging 1.00
R0755:Dnah11 UTSW 12 117954829 missense possibly damaging 0.95
R0755:Dnah11 UTSW 12 118198625 missense probably benign 0.17
R0789:Dnah11 UTSW 12 117911232 missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0835:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0846:Dnah11 UTSW 12 117933850 missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118190844 nonsense probably null
R0928:Dnah11 UTSW 12 118045562 missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118060407 missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117933812 missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117972364 missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118057106 nonsense probably null
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1500:Dnah11 UTSW 12 118012829 synonymous probably null
R1535:Dnah11 UTSW 12 118018730 missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117931256 missense probably benign 0.01
R1554:Dnah11 UTSW 12 118082499 missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R1618:Dnah11 UTSW 12 118015465 missense probably damaging 0.98
R1638:Dnah11 UTSW 12 118015419 missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118120724 missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117933845 missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118190868 missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118196644 missense probably benign 0.32
R1728:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118190825 missense probably benign 0.31
R1780:Dnah11 UTSW 12 118027558 missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118038780 missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118063852 missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118127556 missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118082468 missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118113871 missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 118012716 missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 118020353 missense probably damaging 1.00
R2140:Dnah11 UTSW 12 118008810 missense probably benign 0.01
R2261:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2261:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2262:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2263:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117886686 missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117928330 missense probably damaging 1.00
R2410:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117987427 nonsense probably null
R3499:Dnah11 UTSW 12 117911023 missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3742:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3779:Dnah11 UTSW 12 118130713 splice site probably benign
R3785:Dnah11 UTSW 12 118017602 missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117978453 splice site probably benign
R4014:Dnah11 UTSW 12 117974914 missense probably benign 0.16
R4043:Dnah11 UTSW 12 117879943 missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118106492 missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4074:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4076:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4201:Dnah11 UTSW 12 117966659 missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118130892 missense probably benign 0.06
R4233:Dnah11 UTSW 12 117916791 missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118125843 nonsense probably null
R4430:Dnah11 UTSW 12 117983011 missense probably benign 0.26
R4465:Dnah11 UTSW 12 117987451 missense probably benign 0.09
R4489:Dnah11 UTSW 12 117916896 missense probably benign 0.31
R4572:Dnah11 UTSW 12 118010125 missense probably benign 0.00
R4574:Dnah11 UTSW 12 118012255 critical splice donor site probably null
R4657:Dnah11 UTSW 12 118192427 missense probably benign 0.02
R4709:Dnah11 UTSW 12 118018760 missense probably benign 0.26
R4740:Dnah11 UTSW 12 118120544 missense probably benign 0.28
R4803:Dnah11 UTSW 12 118127608 missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117995200 missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118126883 missense probably benign 0.37
R5018:Dnah11 UTSW 12 118130728 missense probably benign 0.00
R5071:Dnah11 UTSW 12 118082453 nonsense probably null
R5074:Dnah11 UTSW 12 118082453 nonsense probably null
R5080:Dnah11 UTSW 12 118198830 start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 118017700 missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117954751 missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118157361 missense probably benign 0.09
R5252:Dnah11 UTSW 12 118125941 missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117883416 missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118085680 missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117954893 missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118085697 missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117880451 critical splice donor site probably null
R5546:Dnah11 UTSW 12 117975848 missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 118018802 missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117883617 missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118113907 missense probably benign 0.04
R5706:Dnah11 UTSW 12 118023935 missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118127106 missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118192390 missense probably benign
R5884:Dnah11 UTSW 12 118177534 missense probably benign 0.00
R5900:Dnah11 UTSW 12 118082431 splice site probably null
R5905:Dnah11 UTSW 12 117954924 missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117914636 splice site probably null
R5973:Dnah11 UTSW 12 118110952 missense probably benign 0.02
R6024:Dnah11 UTSW 12 118030272 missense probably benign 0.34
R6056:Dnah11 UTSW 12 117928456 missense probably benign 0.03
R6075:Dnah11 UTSW 12 118104851 missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117928456 missense probably benign
R6191:Dnah11 UTSW 12 118190897 missense probably benign
R6197:Dnah11 UTSW 12 118179747 missense probably benign 0.03
R6262:Dnah11 UTSW 12 117931178 missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117916855 missense probably benign 0.01
R6614:Dnah11 UTSW 12 117886676 missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118186882 splice site probably null
R6712:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118045646 missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118113894 missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117987676 intron probably null
R6895:Dnah11 UTSW 12 117995191 missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118106562 missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118198768 missense probably benign
R6945:Dnah11 UTSW 12 118060310 missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117933809 missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118108944 missense probably benign 0.00
R6976:Dnah11 UTSW 12 118198643 missense probably benign 0.16
Z1088:Dnah11 UTSW 12 117895012 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117982969 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cacacacacatacacacacac -3'
Posted On2013-05-23