Incidental Mutation 'R5215:Pard3'
ID403423
Institutional Source Beutler Lab
Gene Symbol Pard3
Ensembl Gene ENSMUSG00000025812
Gene Namepar-3 family cell polarity regulator
SynonymsASIP, PAR-3, Pard3a, Par3, D8Ertd580e
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location127063893-127612286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127378264 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 496 (V496M)
Ref Sequence ENSEMBL: ENSMUSP00000124533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026921] [ENSMUST00000079777] [ENSMUST00000108752] [ENSMUST00000159537] [ENSMUST00000160272] [ENSMUST00000160581] [ENSMUST00000160717] [ENSMUST00000160766] [ENSMUST00000161355] [ENSMUST00000162176] [ENSMUST00000162309] [ENSMUST00000162456] [ENSMUST00000162531] [ENSMUST00000162536] [ENSMUST00000162602] [ENSMUST00000162907]
Predicted Effect probably damaging
Transcript: ENSMUST00000026921
AA Change: V540M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026921
Gene: ENSMUSG00000025812
AA Change: V540M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.1e-72 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 3e-10 PDB
low complexity region 863 875 N/A INTRINSIC
low complexity region 892 902 N/A INTRINSIC
low complexity region 921 950 N/A INTRINSIC
low complexity region 965 1005 N/A INTRINSIC
low complexity region 1162 1200 N/A INTRINSIC
low complexity region 1264 1281 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079777
AA Change: V405M

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078710
Gene: ENSMUSG00000025812
AA Change: V405M

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108752
AA Change: V405M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104383
Gene: ENSMUSG00000025812
AA Change: V405M

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159537
AA Change: V496M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124934
Gene: ENSMUSG00000025812
AA Change: V496M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.7e-73 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 717 727 N/A INTRINSIC
PDB:4DC2|Z 756 783 2e-10 PDB
low complexity region 823 835 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
low complexity region 881 910 N/A INTRINSIC
low complexity region 925 943 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160272
AA Change: V540M

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125453
Gene: ENSMUSG00000025812
AA Change: V540M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.7e-60 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 878 890 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 936 965 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1177 1215 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160581
AA Change: V543M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124141
Gene: ENSMUSG00000025812
AA Change: V543M

DomainStartEndE-ValueType
Pfam:DUF3534 4 149 7.1e-73 PFAM
low complexity region 237 249 N/A INTRINSIC
PDZ 285 364 2.34e-6 SMART
low complexity region 434 443 N/A INTRINSIC
PDZ 472 551 4.1e-20 SMART
PDZ 589 674 9.87e-14 SMART
low complexity region 764 774 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
low complexity region 870 880 N/A INTRINSIC
low complexity region 899 928 N/A INTRINSIC
low complexity region 943 983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160593
Predicted Effect probably damaging
Transcript: ENSMUST00000160717
AA Change: V405M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125612
Gene: ENSMUSG00000025812
AA Change: V405M

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160766
AA Change: V496M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124533
Gene: ENSMUSG00000025812
AA Change: V496M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
low complexity region 820 830 N/A INTRINSIC
low complexity region 849 878 N/A INTRINSIC
low complexity region 893 933 N/A INTRINSIC
low complexity region 1090 1128 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161277
AA Change: V471M
SMART Domains Protein: ENSMUSP00000124789
Gene: ENSMUSG00000025812
AA Change: V471M

DomainStartEndE-ValueType
Pfam:DUF3534 3 122 9.6e-37 PFAM
PDZ 214 293 2.34e-6 SMART
low complexity region 363 372 N/A INTRINSIC
PDZ 401 480 4.1e-20 SMART
PDZ 518 603 9.87e-14 SMART
low complexity region 693 703 N/A INTRINSIC
PDB:4DC2|Z 732 759 2e-10 PDB
low complexity region 799 811 N/A INTRINSIC
low complexity region 828 838 N/A INTRINSIC
low complexity region 857 886 N/A INTRINSIC
low complexity region 901 919 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161355
AA Change: V540M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125064
Gene: ENSMUSG00000025812
AA Change: V540M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 886 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 949 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162176
AA Change: V262M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123944
Gene: ENSMUSG00000025812
AA Change: V262M

DomainStartEndE-ValueType
PDZ 1 83 4.11e-2 SMART
low complexity region 153 162 N/A INTRINSIC
PDZ 191 270 4.1e-20 SMART
PDZ 321 406 9.87e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162309
AA Change: V540M

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124282
Gene: ENSMUSG00000025812
AA Change: V540M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 877 889 N/A INTRINSIC
low complexity region 906 916 N/A INTRINSIC
low complexity region 935 964 N/A INTRINSIC
low complexity region 979 1019 N/A INTRINSIC
low complexity region 1176 1214 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162456
AA Change: V405M

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124162
Gene: ENSMUSG00000025812
AA Change: V405M

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162531
AA Change: V540M

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125610
Gene: ENSMUSG00000025812
AA Change: V540M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 8.4e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 586 671 9.87e-14 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 838 850 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 896 925 N/A INTRINSIC
low complexity region 940 980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162536
AA Change: V496M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125212
Gene: ENSMUSG00000025812
AA Change: V496M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 555 640 9.87e-14 SMART
low complexity region 727 737 N/A INTRINSIC
PDB:4DC2|Z 766 793 3e-10 PDB
low complexity region 833 845 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
low complexity region 891 920 N/A INTRINSIC
low complexity region 935 975 N/A INTRINSIC
low complexity region 1132 1170 N/A INTRINSIC
low complexity region 1234 1251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162602
AA Change: V540M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125450
Gene: ENSMUSG00000025812
AA Change: V540M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 774 784 N/A INTRINSIC
PDB:4DC2|Z 813 840 2e-10 PDB
low complexity region 881 893 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 939 968 N/A INTRINSIC
low complexity region 983 1023 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162665
AA Change: V559M
SMART Domains Protein: ENSMUSP00000124718
Gene: ENSMUSG00000025812
AA Change: V559M

DomainStartEndE-ValueType
Pfam:DUF3534 21 166 1.4e-60 PFAM
low complexity region 254 266 N/A INTRINSIC
PDZ 302 381 2.34e-6 SMART
low complexity region 451 460 N/A INTRINSIC
PDZ 489 568 4.1e-20 SMART
PDZ 619 704 9.87e-14 SMART
low complexity region 791 801 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 926 955 N/A INTRINSIC
low complexity region 970 1010 N/A INTRINSIC
low complexity region 1167 1205 N/A INTRINSIC
low complexity region 1269 1286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162907
AA Change: V540M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124319
Gene: ENSMUSG00000025812
AA Change: V540M

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 4.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163021
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E12.5 associated with growth retardation, abnormal heart development, and abnormal epicardial cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Pard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pard3 APN 8 127359818 splice site probably benign
IGL00484:Pard3 APN 8 127371846 missense probably benign 0.05
IGL00674:Pard3 APN 8 127388678 missense probably damaging 1.00
IGL01471:Pard3 APN 8 127378246 missense probably benign 0.01
IGL01505:Pard3 APN 8 127324063 missense probably damaging 1.00
IGL02252:Pard3 APN 8 127398756 missense probably benign 0.09
IGL02511:Pard3 APN 8 127161320 splice site probably benign
IGL02838:Pard3 APN 8 127426647 missense probably damaging 0.99
IGL02948:Pard3 APN 8 127306494 missense probably benign 0.00
IGL02987:Pard3 APN 8 127389491 missense probably damaging 0.98
IGL03037:Pard3 APN 8 127306494 missense probably benign 0.00
IGL03084:Pard3 APN 8 127593092 missense probably damaging 0.96
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0029:Pard3 UTSW 8 127426758 splice site probably benign
R0109:Pard3 UTSW 8 127398666 missense probably damaging 1.00
R0309:Pard3 UTSW 8 127376897 splice site probably benign
R0415:Pard3 UTSW 8 127610566 missense probably damaging 1.00
R0507:Pard3 UTSW 8 127371486 splice site probably benign
R1055:Pard3 UTSW 8 127378280 missense probably benign 0.34
R1305:Pard3 UTSW 8 127306410 missense possibly damaging 0.62
R1619:Pard3 UTSW 8 127380502 missense probably benign 0.02
R1855:Pard3 UTSW 8 127447812 splice site probably null
R2001:Pard3 UTSW 8 127064347 utr 5 prime probably null
R2060:Pard3 UTSW 8 127398604 missense probably benign 0.05
R2064:Pard3 UTSW 8 127610611 missense probably damaging 1.00
R2113:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R2136:Pard3 UTSW 8 127376885 critical splice donor site probably null
R2224:Pard3 UTSW 8 127359776 missense probably damaging 1.00
R2252:Pard3 UTSW 8 127610599 missense probably damaging 1.00
R3870:Pard3 UTSW 8 127409686 missense probably damaging 1.00
R4154:Pard3 UTSW 8 127474396 missense probably damaging 1.00
R4212:Pard3 UTSW 8 127610458 missense probably benign 0.43
R4243:Pard3 UTSW 8 127371647 missense probably benign 0.09
R4523:Pard3 UTSW 8 127398627 missense probably benign 0.08
R4857:Pard3 UTSW 8 127324054 missense probably damaging 0.98
R4876:Pard3 UTSW 8 127561469 intron probably benign
R4877:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R5197:Pard3 UTSW 8 127073290 splice site probably null
R5279:Pard3 UTSW 8 127460386 critical splice donor site probably null
R5349:Pard3 UTSW 8 127415743 missense probably damaging 1.00
R5479:Pard3 UTSW 8 127370355 missense probably damaging 1.00
R5514:Pard3 UTSW 8 127426605 missense probably damaging 1.00
R5681:Pard3 UTSW 8 127389433 missense possibly damaging 0.81
R5934:Pard3 UTSW 8 127389338 missense probably damaging 1.00
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6187:Pard3 UTSW 8 127073273 missense probably benign 0.00
R6382:Pard3 UTSW 8 127376783 missense probably damaging 1.00
R6774:Pard3 UTSW 8 127410747 missense probably damaging 0.98
R7130:Pard3 UTSW 8 127415683 missense probably damaging 1.00
R7267:Pard3 UTSW 8 127371575 missense probably damaging 0.97
R7358:Pard3 UTSW 8 127593092 missense probably damaging 0.98
R7528:Pard3 UTSW 8 127603165 missense probably damaging 1.00
R7537:Pard3 UTSW 8 127610582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTACTAACCAACACTGTCAGTTC -3'
(R):5'- GCGTCTATTGCTAAGACTGGC -3'

Sequencing Primer
(F):5'- TAACCAACACTGTCAGTTCTGGATC -3'
(R):5'- CTAAGACTGGCGTGGTTGAGAATG -3'
Posted On2016-07-22