Incidental Mutation 'R5216:Atp9a'
ID403464
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission 042789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5216 (G1)
Quality Score219
Status Not validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 168674888 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 362 (I362V)
Ref Sequence ENSEMBL: ENSMUSP00000136793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000178504]
Predicted Effect probably benign
Transcript: ENSMUST00000029060
AA Change: I362V

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546
AA Change: I362V

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109175
AA Change: I346V

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546
AA Change: I346V

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109176
AA Change: I420V

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546
AA Change: I420V

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109177
AA Change: I344V

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546
AA Change: I344V

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147757
Predicted Effect probably benign
Transcript: ENSMUST00000178504
AA Change: I362V

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546
AA Change: I362V

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7422:Atp9a UTSW 2 168648593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCTTGGTGCACTAGGG -3'
(R):5'- GAAAAGCTTCCACACGGCTG -3'

Sequencing Primer
(F):5'- GGAGAAAGACAGCTGCCACAC -3'
(R):5'- CACGGCTGTGTGGCAGG -3'
Posted On2016-07-22