Incidental Mutation 'R5217:Mdn1'
ID403519
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Namemidasin AAA ATPase 1
Synonyms4833432B22Rik, LOC213784, D4Abb1e
MMRRC Submission 042790-MU
Accession Numbers

Genbank: NM_001081392; MGI: 1926159

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R5217 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32657119-32775217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32723690 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 2542 (P2542L)
Ref Sequence ENSEMBL: ENSMUSP00000136222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071642
AA Change: P2542L

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: P2542L

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150934
Predicted Effect probably damaging
Transcript: ENSMUST00000178134
AA Change: P2542L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: P2542L

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (80/80)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,433,726 L28H probably damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
Abhd11 T A 5: 135,011,544 W144R probably damaging Het
Abhd2 A G 7: 79,323,630 E119G probably benign Het
Acbd3 A G 1: 180,726,373 Y91C probably benign Het
Aox4 C A 1: 58,246,241 S628* probably null Het
Bahcc1 T A 11: 120,274,459 Y905* probably null Het
Baiap2l2 T G 15: 79,270,487 S211R probably benign Het
C77080 C T 4: 129,222,685 E729K probably damaging Het
Cab39l T A 14: 59,526,809 Y206* probably null Het
Cacna1i A T 15: 80,390,840 T1830S possibly damaging Het
Catsperg1 A T 7: 29,190,298 L793* probably null Het
Cdh10 G T 15: 18,966,022 V198F probably damaging Het
Cenpk A T 13: 104,249,409 I271F probably damaging Het
Chchd4 A T 6: 91,465,278 C53S probably damaging Het
Cluh T G 11: 74,659,705 C252W probably damaging Het
Cmklr1 G T 5: 113,614,649 A97E probably damaging Het
Coil C A 11: 88,981,161 A116D possibly damaging Het
F830045P16Rik C A 2: 129,463,573 V294F probably damaging Het
Fgd6 T A 10: 94,134,077 M1196K possibly damaging Het
Gabra5 G A 7: 57,490,856 S31L probably benign Het
Gm10264 A G 12: 88,329,426 H58R probably benign Het
Gm7135 A T 1: 97,435,065 noncoding transcript Het
Gon4l C A 3: 88,887,575 T695K probably damaging Het
Hectd4 A G 5: 121,353,551 H3684R possibly damaging Het
Ica1l T A 1: 60,015,758 M105L probably benign Het
Igkv8-24 A T 6: 70,217,402 V7D probably damaging Het
Klf10 G A 15: 38,296,087 R420W probably damaging Het
Klrc2 C A 6: 129,656,880 W177C probably damaging Het
Krit1 T A 5: 3,806,451 C15* probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrrc37a C T 11: 103,456,954 V2972I unknown Het
Mapkapk5 T C 5: 121,534,429 D13G probably damaging Het
Mcph1 T A 8: 18,788,473 L804I probably damaging Het
Mrto4 A G 4: 139,348,459 Y119H probably benign Het
Nbeal2 G T 9: 110,632,090 A1635E possibly damaging Het
Ndc1 T C 4: 107,389,576 S399P probably benign Het
Ndufv2 A G 17: 66,087,429 I147T probably damaging Het
Neb C A 2: 52,162,130 E382* probably null Het
Nme8 T A 13: 19,696,691 I32F probably damaging Het
Obox5 T A 7: 15,757,868 probably null Het
Olfr937 A G 9: 39,059,769 V299A probably benign Het
Pcdhb19 A T 18: 37,497,886 M245L probably benign Het
Pex5l A T 3: 33,007,328 probably null Het
Phrf1 T G 7: 141,260,703 D1270E probably damaging Het
Pik3r5 A G 11: 68,491,964 K277E possibly damaging Het
Ppan T C 9: 20,890,925 V204A possibly damaging Het
Ppp1r9a A T 6: 5,115,367 N830I probably damaging Het
Pxn C G 5: 115,544,915 A92G probably benign Het
Qsox1 A G 1: 155,790,996 V249A probably benign Het
Rgl3 T A 9: 21,987,648 *88C probably null Het
Rps6kc1 A T 1: 190,783,605 W975R probably damaging Het
Sash1 G T 10: 8,780,604 A208D possibly damaging Het
Simc1 A T 13: 54,539,896 probably benign Het
Sox7 T C 14: 63,948,000 Y162H probably damaging Het
Srp72 T A 5: 76,980,528 L171H probably damaging Het
Stab1 T A 14: 31,159,519 Y577F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tagln T C 9: 45,930,879 T139A probably benign Het
Thbs3 T C 3: 89,223,164 probably null Het
Tmem216 G A 19: 10,551,791 T131M possibly damaging Het
Tmprss11c A G 5: 86,256,390 V142A probably benign Het
Ttc30a1 A G 2: 75,980,803 L312P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc5 C G 11: 76,694,276 A164G possibly damaging Het
Ubtf T C 11: 102,308,302 M511V probably null Het
Ugt2b36 A T 5: 87,066,255 V510E probably damaging Het
Vars2 G C 17: 35,658,149 P887A probably damaging Het
Vmn2r80 A G 10: 79,169,146 M206V possibly damaging Het
Zbtb5 A G 4: 44,993,990 F465L probably benign Het
Zfp119a G A 17: 55,865,425 Q473* probably null Het
Zfp607a T G 7: 27,877,844 I113R probably damaging Het
Zmym6 C A 4: 127,105,374 N450K possibly damaging Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32723651 missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32719214 missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32735719 missense probably benign
IGL00573:Mdn1 APN 4 32666619 critical splice donor site probably null
IGL00983:Mdn1 APN 4 32735525 missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32730864 missense probably benign 0.00
IGL01359:Mdn1 APN 4 32743686 missense probably benign 0.10
IGL01457:Mdn1 APN 4 32715922 missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32711938 splice site probably benign
IGL01684:Mdn1 APN 4 32726857 missense probably benign
IGL01753:Mdn1 APN 4 32708483 missense probably benign
IGL01901:Mdn1 APN 4 32669591 missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32723657 missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32758393 missense probably benign 0.14
IGL02019:Mdn1 APN 4 32749948 missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32715708 missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32709364 missense probably benign 0.00
IGL02154:Mdn1 APN 4 32740395 missense probably benign 0.35
IGL02216:Mdn1 APN 4 32739092 missense probably benign 0.03
IGL02371:Mdn1 APN 4 32676860
IGL02396:Mdn1 APN 4 32700120 missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32694674 critical splice donor site probably null
IGL02502:Mdn1 APN 4 32670579 missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32763199 missense probably benign 0.05
IGL02946:Mdn1 APN 4 32734366 missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32713360 splice site probably benign
IGL03076:Mdn1 APN 4 32735564 missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32729994 missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32732842 missense probably benign 0.06
3-1:Mdn1 UTSW 4 32725967 critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32694495 missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32749934 missense probably benign 0.05
R0008:Mdn1 UTSW 4 32718317 missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0125:Mdn1 UTSW 4 32729956 missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32693534 missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32750318 missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32746439 critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32684707 missense probably benign 0.39
R0450:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0465:Mdn1 UTSW 4 32699204 splice site probably benign
R0469:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0477:Mdn1 UTSW 4 32750928 missense probably benign 0.02
R0481:Mdn1 UTSW 4 32767182 splice site probably benign
R0504:Mdn1 UTSW 4 32698916 splice site probably benign
R0522:Mdn1 UTSW 4 32672837 missense probably benign 0.09
R0550:Mdn1 UTSW 4 32730479 missense probably benign 0.13
R0607:Mdn1 UTSW 4 32712014 missense probably damaging 1.00
R0607:Mdn1 UTSW 4 32732829 missense probably benign 0.36
R0664:Mdn1 UTSW 4 32768011 nonsense probably null
R0701:Mdn1 UTSW 4 32699263 missense probably benign 0.00
R0801:Mdn1 UTSW 4 32668895 missense probably benign 0.04
R0841:Mdn1 UTSW 4 32752032 missense probably benign 0.23
R0849:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32701713 missense probably benign 0.01
R1114:Mdn1 UTSW 4 32746568 critical splice donor site probably null
R1137:Mdn1 UTSW 4 32694511 missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32667089 critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32700334 splice site probably benign
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1518:Mdn1 UTSW 4 32739977 missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32723501 missense probably null 0.10
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1591:Mdn1 UTSW 4 32700092 missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32663050 missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32700417 missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32693504 missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32773952 missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32700103 missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32720761 missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32730881 missense probably benign 0.17
R1870:Mdn1 UTSW 4 32763339 missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32742540 missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32760839 small deletion probably benign
R2075:Mdn1 UTSW 4 32716058 missense probably benign 0.03
R2103:Mdn1 UTSW 4 32738712 missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32743843 splice site probably null
R2110:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32716271 missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32763306 missense probably benign 0.37
R2240:Mdn1 UTSW 4 32765701 missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32750010 missense probably benign 0.21
R2421:Mdn1 UTSW 4 32723621 missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32750013 missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3435:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3783:Mdn1 UTSW 4 32720818 missense probably benign 0.01
R3811:Mdn1 UTSW 4 32693506 nonsense probably null
R3973:Mdn1 UTSW 4 32722363 missense probably benign 0.00
R4154:Mdn1 UTSW 4 32707475 missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32743809 missense probably benign 0.03
R4393:Mdn1 UTSW 4 32754482 missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32704635 missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32668860 missense probably benign 0.00
R4509:Mdn1 UTSW 4 32715883 missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32722334 missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32754437 missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32741812 missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32707636 missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32730749 splice site probably null
R4667:Mdn1 UTSW 4 32679572 missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32666430 missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32683583 nonsense probably null
R4807:Mdn1 UTSW 4 32685651 splice site probably null
R4923:Mdn1 UTSW 4 32671608 missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32707459 missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32756512 missense probably benign 0.00
R4971:Mdn1 UTSW 4 32739827 missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32734418 missense probably benign 0.01
R5122:Mdn1 UTSW 4 32670593 missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32774008 missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32759011 intron probably null
R5215:Mdn1 UTSW 4 32741418 missense possibly damaging 0.78
R5219:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32720897 missense probably benign
R5522:Mdn1 UTSW 4 32685783 missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32767961 missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32728167 missense probably benign 0.04
R5605:Mdn1 UTSW 4 32765664 missense probably benign
R5621:Mdn1 UTSW 4 32716371 missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32695480 missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32667467 splice site probably null
R5780:Mdn1 UTSW 4 32722950 missense probably benign 0.02
R5838:Mdn1 UTSW 4 32754547 missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32670646 missense probably benign 0.09
R5895:Mdn1 UTSW 4 32695400 missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32678330 missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32741073 missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32715713 missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32689581 missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32684735 missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32716040 missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32715953 missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32696269 missense probably benign 0.12
R6249:Mdn1 UTSW 4 32708484 missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32748590 missense probably benign 0.13
R6253:Mdn1 UTSW 4 32749593 missense probably benign 0.25
R6273:Mdn1 UTSW 4 32715979 missense probably benign 0.01
R6297:Mdn1 UTSW 4 32730054 nonsense probably null
R6384:Mdn1 UTSW 4 32670607 missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32773308 missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32713780 missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32676786 missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32741893 missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32748614 missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
X0066:Mdn1 UTSW 4 32739030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGCAGACTTGTAGCCCTG -3'
(R):5'- AGTCCCTGAAATATCGAGGCATTC -3'

Sequencing Primer
(F):5'- TGACGACCTGACGTTCAATG -3'
(R):5'- GCATTCCTCTTGATACATAAGGGGC -3'
Posted On2016-07-22