Incidental Mutation 'R5217:Gabra5'
ID403540
Institutional Source Beutler Lab
Gene Symbol Gabra5
Ensembl Gene ENSMUSG00000055078
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 5
SynonymsA230018I05Rik
MMRRC Submission 042790-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R5217 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location57407672-57510059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57490856 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 31 (S31L)
Ref Sequence ENSEMBL: ENSMUSP00000145685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068456] [ENSMUST00000085240] [ENSMUST00000206382] [ENSMUST00000206734]
Predicted Effect probably benign
Transcript: ENSMUST00000068456
AA Change: S31L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000063276
Gene: ENSMUSG00000055078
AA Change: S31L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 49 257 3e-50 PFAM
Pfam:Neur_chan_memb 264 375 2.3e-33 PFAM
low complexity region 407 419 N/A INTRINSIC
transmembrane domain 432 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085240
SMART Domains Protein: ENSMUSP00000082337
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 5.1e-51 PFAM
Pfam:Neur_chan_memb 250 468 1.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206382
AA Change: S31L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000206734
AA Change: S31L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Transcript variants utilizing three different alternative non-coding first exons have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice having disruptions in this gene display abnormalities in hearing and in ear structure. Subtle abnormalities in learning and in conditioning have also been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,433,726 L28H probably damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
Abhd11 T A 5: 135,011,544 W144R probably damaging Het
Abhd2 A G 7: 79,323,630 E119G probably benign Het
Acbd3 A G 1: 180,726,373 Y91C probably benign Het
Aox4 C A 1: 58,246,241 S628* probably null Het
Bahcc1 T A 11: 120,274,459 Y905* probably null Het
Baiap2l2 T G 15: 79,270,487 S211R probably benign Het
C77080 C T 4: 129,222,685 E729K probably damaging Het
Cab39l T A 14: 59,526,809 Y206* probably null Het
Cacna1i A T 15: 80,390,840 T1830S possibly damaging Het
Catsperg1 A T 7: 29,190,298 L793* probably null Het
Cdh10 G T 15: 18,966,022 V198F probably damaging Het
Cenpk A T 13: 104,249,409 I271F probably damaging Het
Chchd4 A T 6: 91,465,278 C53S probably damaging Het
Cluh T G 11: 74,659,705 C252W probably damaging Het
Cmklr1 G T 5: 113,614,649 A97E probably damaging Het
Coil C A 11: 88,981,161 A116D possibly damaging Het
F830045P16Rik C A 2: 129,463,573 V294F probably damaging Het
Fgd6 T A 10: 94,134,077 M1196K possibly damaging Het
Gm10264 A G 12: 88,329,426 H58R probably benign Het
Gm7135 A T 1: 97,435,065 noncoding transcript Het
Gon4l C A 3: 88,887,575 T695K probably damaging Het
Hectd4 A G 5: 121,353,551 H3684R possibly damaging Het
Ica1l T A 1: 60,015,758 M105L probably benign Het
Igkv8-24 A T 6: 70,217,402 V7D probably damaging Het
Klf10 G A 15: 38,296,087 R420W probably damaging Het
Klrc2 C A 6: 129,656,880 W177C probably damaging Het
Krit1 T A 5: 3,806,451 C15* probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrrc37a C T 11: 103,456,954 V2972I unknown Het
Mapkapk5 T C 5: 121,534,429 D13G probably damaging Het
Mcph1 T A 8: 18,788,473 L804I probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrto4 A G 4: 139,348,459 Y119H probably benign Het
Nbeal2 G T 9: 110,632,090 A1635E possibly damaging Het
Ndc1 T C 4: 107,389,576 S399P probably benign Het
Ndufv2 A G 17: 66,087,429 I147T probably damaging Het
Neb C A 2: 52,162,130 E382* probably null Het
Nme8 T A 13: 19,696,691 I32F probably damaging Het
Obox5 T A 7: 15,757,868 probably null Het
Olfr937 A G 9: 39,059,769 V299A probably benign Het
Pcdhb19 A T 18: 37,497,886 M245L probably benign Het
Pex5l A T 3: 33,007,328 probably null Het
Phrf1 T G 7: 141,260,703 D1270E probably damaging Het
Pik3r5 A G 11: 68,491,964 K277E possibly damaging Het
Ppan T C 9: 20,890,925 V204A possibly damaging Het
Ppp1r9a A T 6: 5,115,367 N830I probably damaging Het
Pxn C G 5: 115,544,915 A92G probably benign Het
Qsox1 A G 1: 155,790,996 V249A probably benign Het
Rgl3 T A 9: 21,987,648 *88C probably null Het
Rps6kc1 A T 1: 190,783,605 W975R probably damaging Het
Sash1 G T 10: 8,780,604 A208D possibly damaging Het
Simc1 A T 13: 54,539,896 probably benign Het
Sox7 T C 14: 63,948,000 Y162H probably damaging Het
Srp72 T A 5: 76,980,528 L171H probably damaging Het
Stab1 T A 14: 31,159,519 Y577F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tagln T C 9: 45,930,879 T139A probably benign Het
Thbs3 T C 3: 89,223,164 probably null Het
Tmem216 G A 19: 10,551,791 T131M possibly damaging Het
Tmprss11c A G 5: 86,256,390 V142A probably benign Het
Ttc30a1 A G 2: 75,980,803 L312P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc5 C G 11: 76,694,276 A164G possibly damaging Het
Ubtf T C 11: 102,308,302 M511V probably null Het
Ugt2b36 A T 5: 87,066,255 V510E probably damaging Het
Vars2 G C 17: 35,658,149 P887A probably damaging Het
Vmn2r80 A G 10: 79,169,146 M206V possibly damaging Het
Zbtb5 A G 4: 44,993,990 F465L probably benign Het
Zfp119a G A 17: 55,865,425 Q473* probably null Het
Zfp607a T G 7: 27,877,844 I113R probably damaging Het
Zmym6 C A 4: 127,105,374 N450K possibly damaging Het
Other mutations in Gabra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gabra5 APN 7 57488988 missense probably damaging 1.00
IGL01475:Gabra5 APN 7 57408684 missense probably damaging 1.00
IGL02750:Gabra5 APN 7 57507991 missense probably benign 0.01
R0003:Gabra5 UTSW 7 57413728 missense probably damaging 1.00
R1519:Gabra5 UTSW 7 57408893 missense probably benign 0.39
R1740:Gabra5 UTSW 7 57421842 missense probably benign
R1766:Gabra5 UTSW 7 57508048 missense probably benign 0.05
R1865:Gabra5 UTSW 7 57489192 nonsense probably null
R2024:Gabra5 UTSW 7 57488950 missense probably damaging 1.00
R2143:Gabra5 UTSW 7 57489015 missense probably damaging 1.00
R2444:Gabra5 UTSW 7 57408875 missense probably benign
R2829:Gabra5 UTSW 7 57490835 missense probably benign
R2966:Gabra5 UTSW 7 57408641 missense probably damaging 0.99
R4014:Gabra5 UTSW 7 57489010 missense probably damaging 1.00
R4876:Gabra5 UTSW 7 57413665 missense probably damaging 1.00
R4936:Gabra5 UTSW 7 57408799 missense probably benign 0.32
R5360:Gabra5 UTSW 7 57490785 missense probably damaging 1.00
R6021:Gabra5 UTSW 7 57507992 missense probably benign 0.00
R6340:Gabra5 UTSW 7 57413748 missense probably damaging 1.00
R6351:Gabra5 UTSW 7 57413780 missense probably damaging 1.00
R6751:Gabra5 UTSW 7 57418334 missense probably damaging 1.00
X0028:Gabra5 UTSW 7 57488911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAATTCTCTCAGAAGTTCAGTTGGAG -3'
(R):5'- AGAATAGTCAAGATCCAGGGCTC -3'

Sequencing Primer
(F):5'- AGAAGTTCAGTTGGAGTATCTTTACG -3'
(R):5'- TCCAGGGCTCATTAAAGGAATC -3'
Posted On2016-07-22