Incidental Mutation 'R5217:Coil'
ID403555
Institutional Source Beutler Lab
Gene Symbol Coil
Ensembl Gene ENSMUSG00000033983
Gene Namecoilin
SynonymsCln80, p80-coilin
MMRRC Submission 042790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R5217 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location88970252-88991613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88981161 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 116 (A116D)
Ref Sequence ENSEMBL: ENSMUSP00000103530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036649] [ENSMUST00000107898]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036649
AA Change: A116D

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047588
Gene: ENSMUSG00000033983
AA Change: A116D

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 161 167 N/A INTRINSIC
low complexity region 174 195 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 401 417 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107898
AA Change: A116D

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103530
Gene: ENSMUSG00000033983
AA Change: A116D

DomainStartEndE-ValueType
Pfam:Coilin_N 10 220 8.7e-35 PFAM
low complexity region 303 325 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135325
AA Change: A169D

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119450
Gene: ENSMUSG00000033983
AA Change: A169D

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 217 223 N/A INTRINSIC
low complexity region 230 251 N/A INTRINSIC
low complexity region 356 378 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral component of Cajal bodies (also called coiled bodies). Cajal bodies are nuclear suborganelles of varying number and composition that are involved in the post-transcriptional modification of small nuclear and small nucleolar RNAs. The N-terminus of the coilin protein directs its self-oligomerization while the C-terminus influences the number of nuclear bodies assembled per cell. Differential methylation and phosphorylation of coilin likely influences its localization among nuclear bodies and the composition and assembly of Cajal bodies. This gene has pseudogenes on chromosome 4 and chromosome 14. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show reduced viability on inbred backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,433,726 L28H probably damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
Abhd11 T A 5: 135,011,544 W144R probably damaging Het
Abhd2 A G 7: 79,323,630 E119G probably benign Het
Acbd3 A G 1: 180,726,373 Y91C probably benign Het
Aox4 C A 1: 58,246,241 S628* probably null Het
Bahcc1 T A 11: 120,274,459 Y905* probably null Het
Baiap2l2 T G 15: 79,270,487 S211R probably benign Het
C77080 C T 4: 129,222,685 E729K probably damaging Het
Cab39l T A 14: 59,526,809 Y206* probably null Het
Cacna1i A T 15: 80,390,840 T1830S possibly damaging Het
Catsperg1 A T 7: 29,190,298 L793* probably null Het
Cdh10 G T 15: 18,966,022 V198F probably damaging Het
Cenpk A T 13: 104,249,409 I271F probably damaging Het
Chchd4 A T 6: 91,465,278 C53S probably damaging Het
Cluh T G 11: 74,659,705 C252W probably damaging Het
Cmklr1 G T 5: 113,614,649 A97E probably damaging Het
F830045P16Rik C A 2: 129,463,573 V294F probably damaging Het
Fgd6 T A 10: 94,134,077 M1196K possibly damaging Het
Gabra5 G A 7: 57,490,856 S31L probably benign Het
Gm10264 A G 12: 88,329,426 H58R probably benign Het
Gm7135 A T 1: 97,435,065 noncoding transcript Het
Gon4l C A 3: 88,887,575 T695K probably damaging Het
Hectd4 A G 5: 121,353,551 H3684R possibly damaging Het
Ica1l T A 1: 60,015,758 M105L probably benign Het
Igkv8-24 A T 6: 70,217,402 V7D probably damaging Het
Klf10 G A 15: 38,296,087 R420W probably damaging Het
Klrc2 C A 6: 129,656,880 W177C probably damaging Het
Krit1 T A 5: 3,806,451 C15* probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrrc37a C T 11: 103,456,954 V2972I unknown Het
Mapkapk5 T C 5: 121,534,429 D13G probably damaging Het
Mcph1 T A 8: 18,788,473 L804I probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrto4 A G 4: 139,348,459 Y119H probably benign Het
Nbeal2 G T 9: 110,632,090 A1635E possibly damaging Het
Ndc1 T C 4: 107,389,576 S399P probably benign Het
Ndufv2 A G 17: 66,087,429 I147T probably damaging Het
Neb C A 2: 52,162,130 E382* probably null Het
Nme8 T A 13: 19,696,691 I32F probably damaging Het
Obox5 T A 7: 15,757,868 probably null Het
Olfr937 A G 9: 39,059,769 V299A probably benign Het
Pcdhb19 A T 18: 37,497,886 M245L probably benign Het
Pex5l A T 3: 33,007,328 probably null Het
Phrf1 T G 7: 141,260,703 D1270E probably damaging Het
Pik3r5 A G 11: 68,491,964 K277E possibly damaging Het
Ppan T C 9: 20,890,925 V204A possibly damaging Het
Ppp1r9a A T 6: 5,115,367 N830I probably damaging Het
Pxn C G 5: 115,544,915 A92G probably benign Het
Qsox1 A G 1: 155,790,996 V249A probably benign Het
Rgl3 T A 9: 21,987,648 *88C probably null Het
Rps6kc1 A T 1: 190,783,605 W975R probably damaging Het
Sash1 G T 10: 8,780,604 A208D possibly damaging Het
Simc1 A T 13: 54,539,896 probably benign Het
Sox7 T C 14: 63,948,000 Y162H probably damaging Het
Srp72 T A 5: 76,980,528 L171H probably damaging Het
Stab1 T A 14: 31,159,519 Y577F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tagln T C 9: 45,930,879 T139A probably benign Het
Thbs3 T C 3: 89,223,164 probably null Het
Tmem216 G A 19: 10,551,791 T131M possibly damaging Het
Tmprss11c A G 5: 86,256,390 V142A probably benign Het
Ttc30a1 A G 2: 75,980,803 L312P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc5 C G 11: 76,694,276 A164G possibly damaging Het
Ubtf T C 11: 102,308,302 M511V probably null Het
Ugt2b36 A T 5: 87,066,255 V510E probably damaging Het
Vars2 G C 17: 35,658,149 P887A probably damaging Het
Vmn2r80 A G 10: 79,169,146 M206V possibly damaging Het
Zbtb5 A G 4: 44,993,990 F465L probably benign Het
Zfp119a G A 17: 55,865,425 Q473* probably null Het
Zfp607a T G 7: 27,877,844 I113R probably damaging Het
Zmym6 C A 4: 127,105,374 N450K possibly damaging Het
Other mutations in Coil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Coil APN 11 88981754 missense probably benign 0.02
R0122:Coil UTSW 11 88985007 splice site probably benign
R0211:Coil UTSW 11 88982153 missense probably damaging 1.00
R0288:Coil UTSW 11 88981868 missense probably damaging 1.00
R0396:Coil UTSW 11 88981623 missense probably benign
R0416:Coil UTSW 11 88981986 missense possibly damaging 0.55
R1251:Coil UTSW 11 88982299 missense possibly damaging 0.93
R1481:Coil UTSW 11 88974060 missense possibly damaging 0.87
R1705:Coil UTSW 11 88974136 missense probably damaging 1.00
R1728:Coil UTSW 11 88973976 missense probably damaging 0.98
R1824:Coil UTSW 11 88982097 missense possibly damaging 0.91
R2989:Coil UTSW 11 88987979 missense probably damaging 1.00
R3819:Coil UTSW 11 88981793 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTCTTGGCATTGCACCAGTG -3'
(R):5'- GTTTGGAAGACTTGGAGGCC -3'

Sequencing Primer
(F):5'- CACCAGTGCACGCCAGG -3'
(R):5'- AAGACTTGGAGGCCCTGGTC -3'
Posted On2016-07-22