Incidental Mutation 'R5218:1810011H11Rik'
List |< first << previous [record 59 of 19097] next >> last >|
ID403617
Institutional Source Beutler Lab
Gene Symbol 1810011H11Rik
Ensembl Gene ENSMUSG00000041707
Gene NameRIKEN cDNA 1810011H11 gene
Synonyms
MMRRC Submission 042791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R5218 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32785963-32817984 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 32816836 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000039191] [ENSMUST00000227060] [ENSMUST00000227871]
Predicted Effect probably null
Transcript: ENSMUST00000039191
SMART Domains Protein: ENSMUSP00000132997
Gene: ENSMUSG00000041707

DomainStartEndE-ValueType
Pfam:DUF4514 16 75 3.6e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227060
Predicted Effect probably benign
Transcript: ENSMUST00000227871
Predicted Effect probably null
Transcript: ENSMUST00000228481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228955
Meta Mutation Damage Score 0.6144 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,629,628 N230K possibly damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
5830473C10Rik A G 5: 90,581,918 K400R probably benign Het
Amigo1 A G 3: 108,187,770 probably null Het
Arhgap30 A T 1: 171,408,760 T901S probably benign Het
Arpp21 T C 9: 112,143,431 D264G probably damaging Het
Ccbe1 C T 18: 66,083,158 G165S probably damaging Het
Celsr1 T C 15: 85,932,384 D1786G probably damaging Het
Cntn1 T C 15: 92,339,549 L1008P unknown Het
Dclk2 T A 3: 86,805,678 D489V probably damaging Het
Dip2b T A 15: 100,154,296 D259E probably benign Het
Disp3 T C 4: 148,242,876 S1184G possibly damaging Het
Dync1li2 C T 8: 104,442,547 W36* probably null Het
Ece2 A T 16: 20,618,540 M211L probably benign Het
Edn3 C T 2: 174,761,552 A31V probably benign Het
Enpp2 T C 15: 54,887,586 Q266R possibly damaging Het
Fabp1 C A 6: 71,199,960 Q12K probably damaging Het
Flt1 G A 5: 147,681,928 T199M probably damaging Het
Galns T A 8: 122,598,589 I275F probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gatb A G 3: 85,604,444 I169V probably benign Het
Gpd1 T A 15: 99,720,130 I109N probably damaging Het
Gps2 T C 11: 69,916,295 probably null Het
Hsd17b12 T C 2: 94,083,263 N99D probably benign Het
Itga3 A T 11: 95,062,748 V256E probably benign Het
Kcnma1 T A 14: 23,463,185 Y527F probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrp1 C A 10: 127,548,619 E3580D probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Medag A T 5: 149,422,254 probably benign Het
Ncdn C A 4: 126,750,810 R73L probably benign Het
Nr4a1 T C 15: 101,272,153 V339A probably benign Het
Ocln G T 13: 100,506,314 P420Q probably damaging Het
Olfr206 A T 16: 59,344,907 S265T probably benign Het
Pank4 C T 4: 154,979,728 T681I probably benign Het
Pcdhb6 T A 18: 37,334,335 V103E possibly damaging Het
Pcsk6 T C 7: 66,025,288 F469S probably benign Het
Phrf1 A G 7: 141,261,301 N1353S possibly damaging Het
Pou6f2 A G 13: 18,152,001 I72T probably damaging Het
Ppig T C 2: 69,732,783 probably benign Het
Ptprh T C 7: 4,597,920 S153G probably benign Het
Rab11b T C 17: 33,748,950 N91S probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Slc2a9 A G 5: 38,453,181 S92P probably damaging Het
Slit3 G A 11: 35,684,175 probably null Het
Sox5 T C 6: 143,960,890 I280V possibly damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Tdrd9 C T 12: 112,063,475 probably benign Het
Tmem74 A T 15: 43,867,244 N134K possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 T G 18: 63,679,467 K85N probably benign Het
Vmn2r77 T A 7: 86,802,133 M409K probably damaging Het
Wipf1 T C 2: 73,444,468 D53G probably damaging Het
Wnt10a G A 1: 74,793,595 V116I probably benign Het
Xpot T A 10: 121,619,138 D33V probably damaging Het
Znrf3 C T 11: 5,281,519 V665M possibly damaging Het
Other mutations in 1810011H11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:1810011H11Rik APN 14 32816857 missense probably benign 0.12
IGL03225:1810011H11Rik APN 14 32805176 missense probably damaging 0.97
R0060:1810011H11Rik UTSW 14 32806769 intron probably benign
R0255:1810011H11Rik UTSW 14 32808363 missense possibly damaging 0.91
R1520:1810011H11Rik UTSW 14 32805126 intron probably benign
R4641:1810011H11Rik UTSW 14 32806882 missense probably damaging 0.99
R6111:1810011H11Rik UTSW 14 32806798 missense possibly damaging 0.93
R6793:1810011H11Rik UTSW 14 32806821 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTTATCTGGCTTCAGCACTG -3'
(R):5'- GCTGTCCATTCGAGCACTTC -3'

Sequencing Primer
(F):5'- GGCTGTAGGCATCTCTCTG -3'
(R):5'- GCAGATACTCTCCCAGAACAGG -3'
Posted On2016-07-22