Incidental Mutation 'R5229:Gm15446'
ID403654
Institutional Source Beutler Lab
Gene Symbol Gm15446
Ensembl Gene ENSMUSG00000090015
Gene Namepredicted gene 15446
Synonyms
MMRRC Submission 042802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5229 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109923400-109943936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 109943170 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 429 (H429Q)
Ref Sequence ENSEMBL: ENSMUSP00000108163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112544] [ENSMUST00000170826]
Predicted Effect probably damaging
Transcript: ENSMUST00000112544
AA Change: H429Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108163
Gene: ENSMUSG00000090015
AA Change: H429Q

DomainStartEndE-ValueType
KRAB 4 60 1.74e-14 SMART
ZnF_C2H2 103 125 1.1e-2 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 4.87e-4 SMART
ZnF_C2H2 187 209 3.39e-3 SMART
ZnF_C2H2 215 237 1.76e-1 SMART
ZnF_C2H2 243 265 1.3e-4 SMART
ZnF_C2H2 271 293 1.1e-2 SMART
ZnF_C2H2 299 321 2.27e-4 SMART
ZnF_C2H2 327 349 6.99e-5 SMART
ZnF_C2H2 355 377 5.21e-4 SMART
ZnF_C2H2 383 405 9.73e-4 SMART
ZnF_C2H2 411 433 3.39e-3 SMART
ZnF_C2H2 439 461 1.58e-3 SMART
ZnF_C2H2 467 489 5.14e-3 SMART
ZnF_C2H2 495 517 2.61e-4 SMART
ZnF_C2H2 523 545 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146564
Predicted Effect probably benign
Transcript: ENSMUST00000170826
SMART Domains Protein: ENSMUSP00000127438
Gene: ENSMUSG00000090015

DomainStartEndE-ValueType
KRAB 3 59 1.74e-14 SMART
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T C 1: 16,080,959 probably benign Het
4930562C15Rik A G 16: 4,850,051 I435M possibly damaging Het
8430408G22Rik T C 6: 116,652,031 S112P possibly damaging Het
Adcy5 A G 16: 35,269,070 I546V probably damaging Het
Apob A G 12: 7,977,806 T10A probably benign Het
Brwd1 C A 16: 96,002,209 D2254Y possibly damaging Het
Bub1b C A 2: 118,629,989 D600E probably damaging Het
C87499 T C 4: 88,630,135 D11G possibly damaging Het
Cnga1 A G 5: 72,609,500 S199P probably damaging Het
Cyp3a11 G T 5: 145,855,135 L483I probably benign Het
Dpysl3 C A 18: 43,332,951 G457V probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Epb41 C A 4: 131,978,935 G415C probably damaging Het
Erap1 G A 13: 74,660,375 V69M possibly damaging Het
F2 A T 2: 91,630,241 Y301* probably null Het
F2rl2 A T 13: 95,700,687 N80I possibly damaging Het
Gm8773 A T 5: 5,575,565 Y87F possibly damaging Het
Gpat3 G A 5: 100,883,424 G148D probably damaging Het
Gpr26 A T 7: 131,984,247 R315S probably damaging Het
Hdac9 A C 12: 34,437,164 H100Q probably damaging Het
Heatr5a A T 12: 51,947,978 V457D probably benign Het
Igkv10-96 A G 6: 68,632,239 M24T possibly damaging Het
Igkv2-95-2 A G 6: 68,648,111 noncoding transcript Het
Kdm4a G A 4: 118,146,605 S758F probably damaging Het
Lrg1 A G 17: 56,120,154 W273R probably damaging Het
Man2a1 A T 17: 64,710,734 Q658H probably benign Het
Mapkapk5 T C 5: 121,533,391 probably null Het
Mcm6 T C 1: 128,333,584 D761G possibly damaging Het
Myh8 A T 11: 67,284,484 Y286F probably damaging Het
Nbn C T 4: 15,963,893 T98I probably damaging Het
Nrd1 T C 4: 109,049,108 S685P probably damaging Het
Nudcd3 A G 11: 6,193,238 V80A probably benign Het
Olfr121 A G 17: 37,752,301 H149R probably benign Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pdcd6ip A T 9: 113,678,333 M390K probably damaging Het
Pon1 C T 6: 5,177,295 V205I possibly damaging Het
Ppp4r2 C A 6: 100,865,215 H212Q probably benign Het
Prl2c5 G A 13: 13,185,856 C33Y probably damaging Het
Rbak A G 5: 143,174,162 F379L probably damaging Het
Rcc2 G A 4: 140,717,029 D344N probably damaging Het
Rgs3 T C 4: 62,702,187 L550P probably damaging Het
Rnasek A T 11: 70,239,660 M25K probably damaging Het
Scgb1b24 A T 7: 33,744,095 T60S possibly damaging Het
Scn5a A G 9: 119,535,976 F392S probably damaging Het
Scpep1 A T 11: 88,937,045 V209E probably damaging Het
Slc35g1 A G 19: 38,402,632 probably null Het
Sorbs1 A G 19: 40,340,707 I554T probably damaging Het
Spats1 A G 17: 45,466,133 probably benign Het
Tdp1 A G 12: 99,893,660 Q202R probably damaging Het
Trav6-5 T G 14: 53,491,588 S102A probably damaging Het
Tspan2 T C 3: 102,768,899 M208T probably damaging Het
Ube4b A G 4: 149,387,178 S84P probably damaging Het
Vmn1r237 C A 17: 21,314,371 Q119K probably benign Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Zfp65 A T 13: 67,708,810 S117T probably benign Het
Other mutations in Gm15446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Gm15446 APN 5 109940802 makesense probably null
R0278:Gm15446 UTSW 5 109943415 missense probably benign 0.14
R0606:Gm15446 UTSW 5 109943481 missense probably benign
R1608:Gm15446 UTSW 5 109942457 missense probably damaging 1.00
R1874:Gm15446 UTSW 5 109942553 missense probably damaging 0.99
R1892:Gm15446 UTSW 5 109943387 missense probably damaging 1.00
R2000:Gm15446 UTSW 5 109942811 missense possibly damaging 0.67
R2059:Gm15446 UTSW 5 109942496 missense probably damaging 1.00
R3083:Gm15446 UTSW 5 109943292 missense possibly damaging 0.48
R3883:Gm15446 UTSW 5 109940447 missense probably damaging 0.98
R4086:Gm15446 UTSW 5 109943255 missense probably benign 0.02
R4095:Gm15446 UTSW 5 109940724 intron probably null
R4459:Gm15446 UTSW 5 109943241 missense probably benign 0.03
R4721:Gm15446 UTSW 5 109943000 missense probably damaging 1.00
R4735:Gm15446 UTSW 5 109942952 missense probably damaging 1.00
R5502:Gm15446 UTSW 5 109940498 nonsense probably null
R6116:Gm15446 UTSW 5 109943036 missense probably damaging 1.00
R6166:Gm15446 UTSW 5 109942780 nonsense probably null
R6322:Gm15446 UTSW 5 109943517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTGTACTAAATCCTTTGCC -3'
(R):5'- TGCCACATTGCTCACATTCATAGG -3'

Sequencing Primer
(F):5'- TTCATACTGGCGAGAAACCTTAC -3'
(R):5'- ACATTGCTCACATTCATAGGGTTTC -3'
Posted On2016-07-22