Incidental Mutation 'R5230:Lgr6'
ID403693
Institutional Source Beutler Lab
Gene Symbol Lgr6
Ensembl Gene ENSMUSG00000042793
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 6
SynonymsA530037C04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5230 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134983301-135105276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134994010 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 199 (A199T)
Ref Sequence ENSEMBL: ENSMUSP00000122334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044828] [ENSMUST00000137968]
Predicted Effect probably damaging
Transcript: ENSMUST00000044828
AA Change: A476T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: A476T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 34 70 5.19e-3 SMART
LRR 64 88 1.03e1 SMART
LRR_TYP 89 112 6.52e-5 SMART
LRR_TYP 113 136 2.71e-2 SMART
LRR_TYP 137 160 4.79e-3 SMART
LRR_TYP 161 184 1.58e-3 SMART
LRR_TYP 185 208 2.36e-2 SMART
LRR_TYP 209 232 3.39e-3 SMART
LRR 233 255 8.97e0 SMART
LRR_TYP 256 279 1.36e-2 SMART
Blast:LRR 281 303 6e-7 BLAST
LRR 327 350 9.24e1 SMART
LRR 351 373 1.41e0 SMART
LRR 374 396 4.84e1 SMART
LRR_TYP 397 420 4.54e-4 SMART
LRR_TYP 421 444 7.15e-2 SMART
transmembrane domain 568 590 N/A INTRINSIC
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 686 708 N/A INTRINSIC
transmembrane domain 728 750 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 808 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137968
AA Change: A199T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122334
Gene: ENSMUSG00000042793
AA Change: A199T

DomainStartEndE-ValueType
Blast:LRR 4 26 2e-7 BLAST
LRR 50 73 9.24e1 SMART
LRR 74 96 1.41e0 SMART
LRR 97 119 4.84e1 SMART
LRR_TYP 120 143 4.54e-4 SMART
LRR_TYP 144 167 7.15e-2 SMART
Pfam:7tm_1 301 550 3.6e-9 PFAM
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,674,861 N1296S probably damaging Het
Abca5 A T 11: 110,319,860 D164E probably benign Het
Adamts5 T C 16: 85,870,068 D512G probably damaging Het
Ankrd11 G A 8: 122,890,477 T2191I probably benign Het
Anxa3 T C 5: 96,838,312 F270S possibly damaging Het
Bard1 A G 1: 71,053,611 probably null Het
Ccdc142 T C 6: 83,107,796 V591A probably damaging Het
Col6a3 C T 1: 90,789,054 E1613K unknown Het
Dnah9 T A 11: 66,084,666 H1519L probably damaging Het
Egf T C 3: 129,718,024 D498G possibly damaging Het
Enah A C 1: 181,935,670 probably benign Het
Fat3 A T 9: 15,990,560 N3056K possibly damaging Het
Gm4846 T A 1: 166,490,179 N223Y probably benign Het
Gm8104 A G 14: 43,101,518 N55S probably damaging Het
Gpatch8 A G 11: 102,479,578 S1045P probably damaging Het
Haus4 A G 14: 54,543,794 M275T probably benign Het
Ighe T A 12: 113,271,386 T385S unknown Het
Ipo9 G A 1: 135,420,070 S78L probably damaging Het
Kif21b G A 1: 136,171,673 V1473M probably damaging Het
Lama1 T A 17: 67,745,083 Y345* probably null Het
Loxl3 A G 6: 83,035,794 T105A probably benign Het
Map4k3 A G 17: 80,615,170 S441P probably benign Het
Med12l C T 3: 59,245,788 T1078I probably damaging Het
Mef2c T A 13: 83,652,907 M242K possibly damaging Het
Morc2b A G 17: 33,136,252 Y849H probably benign Het
Mroh2b T A 15: 4,941,522 V1003E probably benign Het
Myo15 T A 11: 60,502,848 M1135K possibly damaging Het
Nckap1l A T 15: 103,483,639 I834F probably benign Het
Nrg1 T A 8: 31,818,479 Y503F probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1314 A T 2: 112,092,389 I104N probably benign Het
Pcdhga2 T C 18: 37,669,742 V213A probably benign Het
Pdzd2 A T 15: 12,390,033 M826K probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Rnf38 T C 4: 44,149,176 Q57R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpina6 T C 12: 103,651,898 T219A probably benign Het
Spata31d1c T A 13: 65,035,434 N263K probably benign Het
Spef2 T G 15: 9,667,230 I791L possibly damaging Het
Sv2a T C 3: 96,185,460 C159R probably damaging Het
Tbc1d31 T A 15: 57,960,919 L859Q probably damaging Het
Tecta C A 9: 42,394,943 R63L probably damaging Het
Tex52 A G 6: 128,384,816 E252G probably damaging Het
Tnfsf13b A G 8: 10,031,608 I257V possibly damaging Het
Tpk1 A G 6: 43,423,719 L172P probably damaging Het
Trim3 T G 7: 105,619,513 N78T possibly damaging Het
Try5 A G 6: 41,312,378 V88A probably benign Het
Vmn1r222 T G 13: 23,233,002 M14L probably benign Het
Wdr90 A T 17: 25,855,303 V678E probably benign Het
Zan A G 5: 137,454,078 L1543P unknown Het
Other mutations in Lgr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Lgr6 APN 1 135001691 splice site probably benign
IGL02483:Lgr6 APN 1 135001691 splice site probably benign
IGL03270:Lgr6 APN 1 134997704 missense probably damaging 1.00
R0002:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0294:Lgr6 UTSW 1 134987891 missense probably damaging 0.99
R0294:Lgr6 UTSW 1 135105061 missense unknown
R0361:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0390:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0731:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0734:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0741:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0742:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0765:Lgr6 UTSW 1 134993886 missense probably benign 0.04
R0903:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0904:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0905:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0906:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0907:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0908:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0967:Lgr6 UTSW 1 134994012 missense probably damaging 1.00
R1078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1131:Lgr6 UTSW 1 134987304 missense probably damaging 0.98
R1440:Lgr6 UTSW 1 134987472 missense probably damaging 1.00
R1533:Lgr6 UTSW 1 135104932 missense possibly damaging 0.66
R1728:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1728:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1728:Lgr6 UTSW 1 135003476 missense probably benign
R1729:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1729:Lgr6 UTSW 1 134988009 missense probably benign
R1729:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1729:Lgr6 UTSW 1 135003476 missense probably benign
R1730:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1730:Lgr6 UTSW 1 134988009 missense probably benign
R1730:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1730:Lgr6 UTSW 1 135003476 missense probably benign
R1739:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1739:Lgr6 UTSW 1 134988009 missense probably benign
R1739:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1739:Lgr6 UTSW 1 135003476 missense probably benign
R1762:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1762:Lgr6 UTSW 1 134988009 missense probably benign
R1762:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1762:Lgr6 UTSW 1 135003476 missense probably benign
R1782:Lgr6 UTSW 1 134987979 missense probably damaging 0.98
R1783:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1783:Lgr6 UTSW 1 134988009 missense probably benign
R1783:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1783:Lgr6 UTSW 1 135003476 missense probably benign
R1784:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1784:Lgr6 UTSW 1 134988009 missense probably benign
R1784:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1784:Lgr6 UTSW 1 135003476 missense probably benign
R1785:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1785:Lgr6 UTSW 1 134988009 missense probably benign
R1785:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1785:Lgr6 UTSW 1 135003476 missense probably benign
R2020:Lgr6 UTSW 1 135075275 missense probably damaging 1.00
R3104:Lgr6 UTSW 1 135000472 splice site probably null
R4629:Lgr6 UTSW 1 135104932 missense probably damaging 0.99
R4792:Lgr6 UTSW 1 135021806 missense probably benign 0.03
R5001:Lgr6 UTSW 1 134990632 missense probably benign 0.01
R5191:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5194:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5195:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5196:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5197:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5228:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5243:Lgr6 UTSW 1 135109272 unclassified probably benign
R5299:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5300:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5417:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5419:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5601:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5603:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5636:Lgr6 UTSW 1 134987078 missense probably benign 0.28
R5699:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5748:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5767:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5825:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5971:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6138:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6258:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6259:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6260:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6740:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6871:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6984:Lgr6 UTSW 1 134988002 missense possibly damaging 0.54
R6986:Lgr6 UTSW 1 134993956 missense possibly damaging 0.80
R7233:Lgr6 UTSW 1 135000476 critical splice donor site probably null
Z1088:Lgr6 UTSW 1 134988071 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTTCCTTCGGGGTCACAAG -3'
(R):5'- CAGGAATCAGGCTTCAAGATTC -3'

Sequencing Primer
(F):5'- GTCACAAGGATCCCTACTAATACTTC -3'
(R):5'- TTATGGTTGCAAGTCACCACAGC -3'
Posted On2016-07-22