Incidental Mutation 'R5273:Gnrhr'
ID403758
Institutional Source Beutler Lab
Gene Symbol Gnrhr
Ensembl Gene ENSMUSG00000029255
Gene Namegonadotropin releasing hormone receptor
Synonyms
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5273 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86180754-86197901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86182246 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 305 (H305L)
Ref Sequence ENSEMBL: ENSMUSP00000031172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031172] [ENSMUST00000094654] [ENSMUST00000113372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031172
AA Change: H305L

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031172
Gene: ENSMUSG00000029255
AA Change: H305L

DomainStartEndE-ValueType
Pfam:7tm_1 63 322 2.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094654
SMART Domains Protein: ENSMUSP00000092238
Gene: ENSMUSG00000029255

DomainStartEndE-ValueType
Pfam:7tm_1 62 261 6.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113372
SMART Domains Protein: ENSMUSP00000108999
Gene: ENSMUSG00000029255

DomainStartEndE-ValueType
Pfam:7tm_1 60 177 4.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display prepubescent internal reproductive tracts with hypogonadism and hypogonadotrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Gnrhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Gnrhr APN 5 86197303 critical splice donor site probably null
IGL01432:Gnrhr APN 5 86182193 missense probably damaging 1.00
IGL02702:Gnrhr APN 5 86182269 missense possibly damaging 0.69
IGL03367:Gnrhr APN 5 86182331 missense probably benign 0.02
R0483:Gnrhr UTSW 5 86197575 missense probably damaging 1.00
R1873:Gnrhr UTSW 5 86182201 missense probably damaging 1.00
R2199:Gnrhr UTSW 5 86197818 missense probably benign 0.26
R2303:Gnrhr UTSW 5 86197749 missense probably benign 0.01
R4400:Gnrhr UTSW 5 86182249 unclassified probably null
R5320:Gnrhr UTSW 5 86197614 missense possibly damaging 0.95
R6159:Gnrhr UTSW 5 86182357 missense probably damaging 1.00
R6221:Gnrhr UTSW 5 86185403 nonsense probably null
R6629:Gnrhr UTSW 5 86182309 missense probably benign 0.01
R6725:Gnrhr UTSW 5 86185313 missense probably damaging 0.97
X0018:Gnrhr UTSW 5 86197755 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TAATCTAACCTTAAACCCTGCCTTG -3'
(R):5'- GAGAAAGCTGACTAAACATGTACTC -3'

Sequencing Primer
(F):5'- ACCCTGCCTTGTATATAAGTGTG -3'
(R):5'- TTAACAGAACTACAGCTGAATCAGTC -3'
Posted On2016-07-22