Incidental Mutation 'R5273:Kdm6b'
ID403773
Institutional Source Beutler Lab
Gene Symbol Kdm6b
Ensembl Gene ENSMUSG00000018476
Gene NameKDM1 lysine (K)-specific demethylase 6B
SynonymsJmjd3
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5273 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69398508-69413675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69404201 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1080 (P1080Q)
Ref Sequence ENSEMBL: ENSMUSP00000091620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094077]
PDB Structure
The free structure of the mouse C-terminal domain of KDM6B [X-RAY DIFFRACTION]
free KDM6B structure [X-RAY DIFFRACTION]
the crystal structure of KDM6B bound with H3K27me3 peptide [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000094077
AA Change: P1080Q
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476
AA Change: P1080Q

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156562
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysine-specific demethylase that specifically demethylates di- or tri-methylated lysine 27 of histone H3 (H3K27me2 or H3K27me3). H3K27 trimethylation is a repressive epigenetic mark controlling chromatin organization and gene silencing. This protein can also demethylate non-histone proteins such as retinoblastoma protein. Through its demethylation actvity this gene influences cellular differentiation and development, tumorigenesis, inflammatory diseases, and neurodegenerative diseases. This protein has two classical nuclear localization signals at its N-terminus. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a null allele show perinatal death, thick alveolar septum, and absence of air space in the lungs. Mice homozygous for a different null allele die neonatally displaying abnormal lung development, dwarfism, kyphosis, short limbs, and a severe delay in endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Kdm6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Kdm6b APN 11 69406306 missense possibly damaging 0.85
IGL02271:Kdm6b APN 11 69406067 missense possibly damaging 0.65
beine UTSW 11 69403592 missense unknown
knochen UTSW 11 69400055 unclassified probably benign
Ostentatious UTSW 11 69403598 missense unknown
piquant UTSW 11 69403794 missense unknown
tart UTSW 11 69406366 missense probably damaging 1.00
PIT4458001:Kdm6b UTSW 11 69399952 missense unknown
R0455:Kdm6b UTSW 11 69406996 nonsense probably null
R0645:Kdm6b UTSW 11 69405018 missense unknown
R1659:Kdm6b UTSW 11 69407588 missense possibly damaging 0.88
R1855:Kdm6b UTSW 11 69407286 missense probably damaging 0.99
R1962:Kdm6b UTSW 11 69401365 unclassified probably benign
R1993:Kdm6b UTSW 11 69406303 missense probably null 0.85
R2029:Kdm6b UTSW 11 69403592 missense unknown
R2181:Kdm6b UTSW 11 69401126 nonsense probably null
R2215:Kdm6b UTSW 11 69405044 missense unknown
R2904:Kdm6b UTSW 11 69405785 missense possibly damaging 0.63
R2992:Kdm6b UTSW 11 69406307 small deletion probably benign
R3236:Kdm6b UTSW 11 69406366 missense probably damaging 1.00
R3950:Kdm6b UTSW 11 69405615 missense probably damaging 1.00
R4027:Kdm6b UTSW 11 69406268 missense possibly damaging 0.92
R4830:Kdm6b UTSW 11 69403794 missense unknown
R4996:Kdm6b UTSW 11 69405731 missense probably damaging 1.00
R5034:Kdm6b UTSW 11 69401910 splice site probably benign
R5140:Kdm6b UTSW 11 69400055 unclassified probably benign
R5160:Kdm6b UTSW 11 69400768 unclassified probably benign
R5240:Kdm6b UTSW 11 69401904 splice site probably benign
R5386:Kdm6b UTSW 11 69400810 unclassified probably benign
R5597:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5598:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5812:Kdm6b UTSW 11 69405929 missense probably damaging 0.98
R5976:Kdm6b UTSW 11 69403788 critical splice donor site probably null
R6000:Kdm6b UTSW 11 69403598 missense unknown
R6145:Kdm6b UTSW 11 69405026 missense unknown
R6191:Kdm6b UTSW 11 69406758 missense probably benign 0.01
R6256:Kdm6b UTSW 11 69406729 missense probably damaging 0.96
R6304:Kdm6b UTSW 11 69404258 missense unknown
R6917:Kdm6b UTSW 11 69406593 missense probably benign 0.04
R6939:Kdm6b UTSW 11 69406762 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTAACGAGCACAAGCCTAG -3'
(R):5'- CTTGCAGAGTGAGGAGATCCAG -3'

Sequencing Primer
(F):5'- TTGCTGGCACGCATGACATC -3'
(R):5'- TGAGGAGATCCAGGGCCG -3'
Posted On2016-07-22