Incidental Mutation 'R5274:Plch2'
ID403810
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Namephospholipase C, eta 2
SynonymsPlcl4, A930027K05Rik, PLCeta2
MMRRC Submission 042837-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5274 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154983115-155056784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154998954 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 408 (L408Q)
Ref Sequence ENSEMBL: ENSMUSP00000134750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000145662] [ENSMUST00000176194] [ENSMUST00000186598]
Predicted Effect probably damaging
Transcript: ENSMUST00000105631
AA Change: L509Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: L509Q

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127661
Predicted Effect probably benign
Transcript: ENSMUST00000135665
AA Change: L404Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: L404Q

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139976
AA Change: L509Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: L509Q

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145662
AA Change: L433Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119864
Gene: ENSMUSG00000029055
AA Change: L433Q

DomainStartEndE-ValueType
PH 46 155 1.8e-6 SMART
EFh 171 199 7.29e-4 SMART
EFh 207 236 4.67e-2 SMART
Pfam:EF-hand_like 241 323 5.2e-27 PFAM
PLCXc 324 469 6.76e-76 SMART
low complexity region 483 496 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175982
AA Change: L293Q
Predicted Effect probably damaging
Transcript: ENSMUST00000176194
AA Change: L408Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: L408Q

DomainStartEndE-ValueType
PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186598
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 98.0%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Ace T C 11: 105,968,037 M19T probably benign Het
Agl A G 3: 116,772,486 L995P probably damaging Het
AY761185 T C 8: 20,943,873 N90S unknown Het
Brca2 T C 5: 150,539,689 S973P probably benign Het
Cacna1e T C 1: 154,700,504 T66A probably damaging Het
Cbarp T C 10: 80,131,815 S531G possibly damaging Het
Cd96 G T 16: 46,069,703 T319K possibly damaging Het
Chil5 A C 3: 106,028,853 F41C probably damaging Het
Col24a1 A C 3: 145,484,678 E1239D probably benign Het
Dip2b A G 15: 100,212,104 E1490G possibly damaging Het
Dync1li1 T C 9: 114,715,205 V315A possibly damaging Het
Dync2h1 T C 9: 7,116,540 S99G probably benign Het
E2f8 C T 7: 48,867,177 R818H probably damaging Het
Eomes T C 9: 118,480,529 V250A probably damaging Het
Esyt3 T C 9: 99,318,297 T615A probably benign Het
Fbxo38 A T 18: 62,515,069 D799E probably damaging Het
Fdft1 A G 14: 63,152,343 F288S probably damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm4871 C G 5: 145,030,370 E185Q probably damaging Het
Gm5155 T C 7: 17,915,717 probably null Het
Gm5901 C A 7: 105,377,448 P141Q probably damaging Het
Herc1 T A 9: 66,399,409 I933N probably benign Het
Ifih1 T C 2: 62,611,718 Q385R probably benign Het
Ighmbp2 T C 19: 3,265,518 E634G probably damaging Het
Klk6 C G 7: 43,829,129 probably null Het
Kmt2d A G 15: 98,854,230 probably benign Het
Lig3 T A 11: 82,797,292 probably null Het
Lrp1b T C 2: 41,344,444 D310G probably null Het
Mroh6 A G 15: 75,885,000 V571A possibly damaging Het
Olfm5 A G 7: 104,159,983 S132P probably damaging Het
Olfr488 A T 7: 108,255,635 F168I probably benign Het
Olfr659 T C 7: 104,671,526 S275P probably damaging Het
Patj G C 4: 98,518,981 S4T probably damaging Het
Pcdhga12 T A 18: 37,766,422 C102* probably null Het
Pik3ap1 T C 19: 41,281,952 D766G possibly damaging Het
Pnma2 G T 14: 66,916,760 R211L probably damaging Het
Prkg2 T A 5: 98,969,991 H468L probably damaging Het
Rad1 T A 15: 10,487,973 probably null Het
Rims3 A G 4: 120,891,374 D264G probably damaging Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rrm2 T A 12: 24,710,407 Y75* probably null Het
Sall3 T C 18: 80,969,837 N1128S probably benign Het
Slc26a5 T C 5: 21,813,901 T610A possibly damaging Het
Snx29 G T 16: 11,738,404 E766D probably damaging Het
Sox17 A G 1: 4,491,888 V298A possibly damaging Het
Spert A G 14: 75,583,226 V362A probably benign Het
Ss18 G A 18: 14,641,049 Q228* probably null Het
Tas2r121 A G 6: 132,700,848 S54P probably damaging Het
Tctex1d1 A T 4: 103,002,571 T103S possibly damaging Het
Tmem206 T C 1: 191,348,468 V295A probably damaging Het
Ttc21b T C 2: 66,236,283 E342G possibly damaging Het
Ubap2l A G 3: 90,012,730 Y818H probably damaging Het
Usp15 C A 10: 123,168,351 R166I probably damaging Het
Vmn1r34 T G 6: 66,637,139 H205P probably damaging Het
Vmn2r22 A T 6: 123,650,634 M1K probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zdhhc1 T C 8: 105,483,770 N5S probably benign Het
Zfp758 T A 17: 22,375,855 C441S probably benign Het
Zp2 T C 7: 120,138,092 E291G possibly damaging Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0117:Plch2 UTSW 4 154985358 unclassified probably benign
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0514:Plch2 UTSW 4 154998886 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2265:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2281:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5296:Plch2 UTSW 4 154989999 intron probably null
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6092:Plch2 UTSW 4 154984372 missense probably benign 0.02
R6253:Plch2 UTSW 4 155007101 missense probably damaging 1.00
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 intron probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7291:Plch2 UTSW 4 154998472 missense probably damaging 1.00
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTAGATACTGTAATTCTCCAGC -3'
(R):5'- TGGATCGCCTCTTAGAGCAG -3'

Sequencing Primer
(F):5'- AGATACTGTAATTCTCCAGCTTGGC -3'
(R):5'- GCAGACGGCAGATCTTTTACC -3'
Posted On2016-07-22