Incidental Mutation 'R5274:Eomes'
ID403833
Institutional Source Beutler Lab
Gene Symbol Eomes
Ensembl Gene ENSMUSG00000032446
Gene Nameeomesodermin
SynonymsTbr2
MMRRC Submission 042837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5274 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location118478212-118486132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118480529 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 250 (V250A)
Ref Sequence ENSEMBL: ENSMUSP00000118079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035020] [ENSMUST00000111763] [ENSMUST00000150633]
Predicted Effect probably damaging
Transcript: ENSMUST00000035020
AA Change: V317A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035020
Gene: ENSMUSG00000032446
AA Change: V317A

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 7.3e-120 SMART
Pfam:T-box_assoc 484 705 1.6e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111763
AA Change: V317A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107393
Gene: ENSMUSG00000032446
AA Change: V317A

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 5.53e-120 SMART
Blast:TBOX 485 511 6e-8 BLAST
low complexity region 648 659 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150633
AA Change: V250A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118079
Gene: ENSMUSG00000032446
AA Change: V250A

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 60 67 N/A INTRINSIC
low complexity region 144 173 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
TBOX 201 395 8.01e-117 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 98.0%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TBR1 (T-box brain protein 1) sub-family of T-box genes that share the common DNA-binding T-box domain. The encoded protein is a transcription factor which is crucial for embryonic development of mesoderm and the central nervous system in vertebrates. The protein may also be necessary for the differentiation of effector CD8+ T cells which are involved in defense against viral infections. A similar gene disrupted in mice is shown to be essential during trophoblast development and gastrulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to implant, and lack trophoectoderm outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Ace T C 11: 105,968,037 M19T probably benign Het
Agl A G 3: 116,772,486 L995P probably damaging Het
AY761185 T C 8: 20,943,873 N90S unknown Het
Brca2 T C 5: 150,539,689 S973P probably benign Het
Cacna1e T C 1: 154,700,504 T66A probably damaging Het
Cbarp T C 10: 80,131,815 S531G possibly damaging Het
Cd96 G T 16: 46,069,703 T319K possibly damaging Het
Chil5 A C 3: 106,028,853 F41C probably damaging Het
Col24a1 A C 3: 145,484,678 E1239D probably benign Het
Dip2b A G 15: 100,212,104 E1490G possibly damaging Het
Dync1li1 T C 9: 114,715,205 V315A possibly damaging Het
Dync2h1 T C 9: 7,116,540 S99G probably benign Het
E2f8 C T 7: 48,867,177 R818H probably damaging Het
Esyt3 T C 9: 99,318,297 T615A probably benign Het
Fbxo38 A T 18: 62,515,069 D799E probably damaging Het
Fdft1 A G 14: 63,152,343 F288S probably damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm4871 C G 5: 145,030,370 E185Q probably damaging Het
Gm5155 T C 7: 17,915,717 probably null Het
Gm5901 C A 7: 105,377,448 P141Q probably damaging Het
Herc1 T A 9: 66,399,409 I933N probably benign Het
Ifih1 T C 2: 62,611,718 Q385R probably benign Het
Ighmbp2 T C 19: 3,265,518 E634G probably damaging Het
Klk6 C G 7: 43,829,129 probably null Het
Kmt2d A G 15: 98,854,230 probably benign Het
Lig3 T A 11: 82,797,292 probably null Het
Lrp1b T C 2: 41,344,444 D310G probably null Het
Mroh6 A G 15: 75,885,000 V571A possibly damaging Het
Olfm5 A G 7: 104,159,983 S132P probably damaging Het
Olfr488 A T 7: 108,255,635 F168I probably benign Het
Olfr659 T C 7: 104,671,526 S275P probably damaging Het
Patj G C 4: 98,518,981 S4T probably damaging Het
Pcdhga12 T A 18: 37,766,422 C102* probably null Het
Pik3ap1 T C 19: 41,281,952 D766G possibly damaging Het
Plch2 A T 4: 154,998,954 L408Q probably damaging Het
Pnma2 G T 14: 66,916,760 R211L probably damaging Het
Prkg2 T A 5: 98,969,991 H468L probably damaging Het
Rad1 T A 15: 10,487,973 probably null Het
Rims3 A G 4: 120,891,374 D264G probably damaging Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rrm2 T A 12: 24,710,407 Y75* probably null Het
Sall3 T C 18: 80,969,837 N1128S probably benign Het
Slc26a5 T C 5: 21,813,901 T610A possibly damaging Het
Snx29 G T 16: 11,738,404 E766D probably damaging Het
Sox17 A G 1: 4,491,888 V298A possibly damaging Het
Spert A G 14: 75,583,226 V362A probably benign Het
Ss18 G A 18: 14,641,049 Q228* probably null Het
Tas2r121 A G 6: 132,700,848 S54P probably damaging Het
Tctex1d1 A T 4: 103,002,571 T103S possibly damaging Het
Tmem206 T C 1: 191,348,468 V295A probably damaging Het
Ttc21b T C 2: 66,236,283 E342G possibly damaging Het
Ubap2l A G 3: 90,012,730 Y818H probably damaging Het
Usp15 C A 10: 123,168,351 R166I probably damaging Het
Vmn1r34 T G 6: 66,637,139 H205P probably damaging Het
Vmn2r22 A T 6: 123,650,634 M1K probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zdhhc1 T C 8: 105,483,770 N5S probably benign Het
Zfp758 T A 17: 22,375,855 C441S probably benign Het
Zp2 T C 7: 120,138,092 E291G possibly damaging Het
Other mutations in Eomes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Eomes APN 9 118482266 missense probably damaging 1.00
IGL01322:Eomes APN 9 118484830 missense probably benign 0.14
IGL01532:Eomes APN 9 118482249 missense probably damaging 1.00
R0088:Eomes UTSW 9 118478673 missense probably damaging 0.99
R0305:Eomes UTSW 9 118484757 missense probably benign 0.11
R0894:Eomes UTSW 9 118482300 splice site probably null
R1110:Eomes UTSW 9 118484599 missense probably benign 0.29
R1326:Eomes UTSW 9 118484497 nonsense probably null
R1942:Eomes UTSW 9 118484648 missense probably benign 0.01
R2108:Eomes UTSW 9 118478852 missense probably benign 0.09
R2237:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2238:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2239:Eomes UTSW 9 118482291 missense probably damaging 1.00
R3915:Eomes UTSW 9 118481273 missense probably benign 0.01
R4158:Eomes UTSW 9 118478963 missense probably benign
R6894:Eomes UTSW 9 118481285 missense probably damaging 1.00
R7055:Eomes UTSW 9 118480499 missense possibly damaging 0.57
R7115:Eomes UTSW 9 118484489 missense probably benign 0.00
X0021:Eomes UTSW 9 118482258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGTTTCAGGCCGTAGTAGC -3'
(R):5'- AATTTCTCCCCAGCAGCAG -3'

Sequencing Primer
(F):5'- GCCGTAGTAGCCATTTTTGTTTG -3'
(R):5'- CCAGGTTGGGGTGACATGC -3'
Posted On2016-07-22