Incidental Mutation 'R5274:Dip2b'
ID403847
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
MMRRC Submission 042837-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R5274 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100212104 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1490 (E1490G)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: E1256G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: E1256G

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100203
AA Change: E1490G

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: E1490G

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108971
AA Change: E1256G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: E1256G

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 98.0%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Ace T C 11: 105,968,037 M19T probably benign Het
Agl A G 3: 116,772,486 L995P probably damaging Het
AY761185 T C 8: 20,943,873 N90S unknown Het
Brca2 T C 5: 150,539,689 S973P probably benign Het
Cacna1e T C 1: 154,700,504 T66A probably damaging Het
Cbarp T C 10: 80,131,815 S531G possibly damaging Het
Cd96 G T 16: 46,069,703 T319K possibly damaging Het
Chil5 A C 3: 106,028,853 F41C probably damaging Het
Col24a1 A C 3: 145,484,678 E1239D probably benign Het
Dync1li1 T C 9: 114,715,205 V315A possibly damaging Het
Dync2h1 T C 9: 7,116,540 S99G probably benign Het
E2f8 C T 7: 48,867,177 R818H probably damaging Het
Eomes T C 9: 118,480,529 V250A probably damaging Het
Esyt3 T C 9: 99,318,297 T615A probably benign Het
Fbxo38 A T 18: 62,515,069 D799E probably damaging Het
Fdft1 A G 14: 63,152,343 F288S probably damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm4871 C G 5: 145,030,370 E185Q probably damaging Het
Gm5155 T C 7: 17,915,717 probably null Het
Gm5901 C A 7: 105,377,448 P141Q probably damaging Het
Herc1 T A 9: 66,399,409 I933N probably benign Het
Ifih1 T C 2: 62,611,718 Q385R probably benign Het
Ighmbp2 T C 19: 3,265,518 E634G probably damaging Het
Klk6 C G 7: 43,829,129 probably null Het
Kmt2d A G 15: 98,854,230 probably benign Het
Lig3 T A 11: 82,797,292 probably null Het
Lrp1b T C 2: 41,344,444 D310G probably null Het
Mroh6 A G 15: 75,885,000 V571A possibly damaging Het
Olfm5 A G 7: 104,159,983 S132P probably damaging Het
Olfr488 A T 7: 108,255,635 F168I probably benign Het
Olfr659 T C 7: 104,671,526 S275P probably damaging Het
Patj G C 4: 98,518,981 S4T probably damaging Het
Pcdhga12 T A 18: 37,766,422 C102* probably null Het
Pik3ap1 T C 19: 41,281,952 D766G possibly damaging Het
Plch2 A T 4: 154,998,954 L408Q probably damaging Het
Pnma2 G T 14: 66,916,760 R211L probably damaging Het
Prkg2 T A 5: 98,969,991 H468L probably damaging Het
Rad1 T A 15: 10,487,973 probably null Het
Rims3 A G 4: 120,891,374 D264G probably damaging Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rrm2 T A 12: 24,710,407 Y75* probably null Het
Sall3 T C 18: 80,969,837 N1128S probably benign Het
Slc26a5 T C 5: 21,813,901 T610A possibly damaging Het
Snx29 G T 16: 11,738,404 E766D probably damaging Het
Sox17 A G 1: 4,491,888 V298A possibly damaging Het
Spert A G 14: 75,583,226 V362A probably benign Het
Ss18 G A 18: 14,641,049 Q228* probably null Het
Tas2r121 A G 6: 132,700,848 S54P probably damaging Het
Tctex1d1 A T 4: 103,002,571 T103S possibly damaging Het
Tmem206 T C 1: 191,348,468 V295A probably damaging Het
Ttc21b T C 2: 66,236,283 E342G possibly damaging Het
Ubap2l A G 3: 90,012,730 Y818H probably damaging Het
Usp15 C A 10: 123,168,351 R166I probably damaging Het
Vmn1r34 T G 6: 66,637,139 H205P probably damaging Het
Vmn2r22 A T 6: 123,650,634 M1K probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zdhhc1 T C 8: 105,483,770 N5S probably benign Het
Zfp758 T A 17: 22,375,855 C441S probably benign Het
Zp2 T C 7: 120,138,092 E291G possibly damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 unclassified probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 unclassified probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 unclassified probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTCTTAATGCCAACACC -3'
(R):5'- AGATTGAATGTCAGGGCGC -3'

Sequencing Primer
(F):5'- GCCAACACCTTATTGAACGTGTGG -3'
(R):5'- GTAACGCACACTTGATTGAGAC -3'
Posted On2016-07-22