Incidental Mutation 'R5276:Trim63'
ID403932
Institutional Source Beutler Lab
Gene Symbol Trim63
Ensembl Gene ENSMUSG00000028834
Gene Nametripartite motif-containing 63
SynonymsMuRF1, Rnf28
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5276 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134315120-134329629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134323133 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 243 (E243K)
Ref Sequence ENSEMBL: ENSMUSP00000101501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030638] [ENSMUST00000105875]
Predicted Effect probably benign
Transcript: ENSMUST00000030638
AA Change: E243K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030638
Gene: ENSMUSG00000028834
AA Change: E243K

DomainStartEndE-ValueType
RING 23 78 1.4e-8 SMART
BBOX 117 159 1.41e-4 SMART
Blast:BBC 166 292 3e-75 BLAST
PDB:4M3L|D 213 271 3e-28 PDB
low complexity region 324 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105875
AA Change: E243K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101501
Gene: ENSMUSG00000028834
AA Change: E243K

DomainStartEndE-ValueType
RING 23 78 1.4e-8 SMART
BBOX 117 159 1.41e-4 SMART
Blast:BBC 166 292 3e-75 BLAST
PDB:4M3L|D 213 271 3e-28 PDB
low complexity region 323 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135576
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING zinc finger protein family found in striated muscle and iris. The product of this gene is an E3 ubiquitin ligase that localizes to the Z-line and M-line lattices of myofibrils. This protein plays an important role in the atrophy of skeletal and cardiac muscle and is required for the degradation of myosin heavy chain proteins, myosin light chain, myosin binding protein, and for muscle-type creatine kinase. [provided by RefSeq, Feb 2012]
PHENOTYPE: A targeted homozygous mutation in this gene results in resistance to skeletal muscle atrophy in response to nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Trim63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Trim63 APN 4 134325676 missense probably benign 0.00
murfy UTSW 4 134323101 missense probably damaging 1.00
FR4737:Trim63 UTSW 4 134327725 small deletion probably benign
PIT1430001:Trim63 UTSW 4 134321173 splice site probably benign
R0690:Trim63 UTSW 4 134316405 missense probably benign 0.00
R1782:Trim63 UTSW 4 134323038 missense probably benign
R1881:Trim63 UTSW 4 134316391 missense probably damaging 0.98
R2449:Trim63 UTSW 4 134323107 missense probably damaging 0.98
R2917:Trim63 UTSW 4 134323151 missense probably damaging 1.00
R2939:Trim63 UTSW 4 134322997 splice site probably benign
R3746:Trim63 UTSW 4 134315354 missense probably damaging 1.00
R3833:Trim63 UTSW 4 134321196 missense probably benign 0.33
R5823:Trim63 UTSW 4 134316531 missense probably damaging 1.00
R6251:Trim63 UTSW 4 134323226 missense probably benign 0.00
R6312:Trim63 UTSW 4 134325697 missense probably damaging 1.00
R6893:Trim63 UTSW 4 134323101 missense probably damaging 1.00
R6924:Trim63 UTSW 4 134321261 missense probably damaging 0.96
X0027:Trim63 UTSW 4 134327706 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTGTCTCAGAAAGTGCGTTGG -3'
(R):5'- CTGCAATGGCTCGAAATGCC -3'

Sequencing Primer
(F):5'- TCAGAAAGTGCGTTGGGACCC -3'
(R):5'- GGCATTTCACCAAGATTTGAACGG -3'
Posted On2016-07-22