Incidental Mutation 'R5276:Vmn2r72'
ID403942
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5276 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85738254 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 701 (I701F)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063425
AA Change: I701F

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: I701F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATGTATCAGGCAGGTTCC -3'
(R):5'- ATTGGTCATCCCACTACGGTC -3'

Sequencing Primer
(F):5'- GGTTCCTGGCCAAGAAAGCTAC -3'
(R):5'- GGTCATCTGTATCCTGCAGCAG -3'
Posted On2016-07-22