Incidental Mutation 'R5277:Bco1'
ID404007
Institutional Source Beutler Lab
Gene Symbol Bco1
Ensembl Gene ENSMUSG00000031845
Gene Namebeta-carotene oxygenase 1
SynonymsBcdo1, betaCMOOX, Bcmo1, Bcdo, beta-CD, Cmoi
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5277 (G1)
Quality Score198
Status Validated
Chromosome8
Chromosomal Location117095854-117133720 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 117117389 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034308] [ENSMUST00000167370] [ENSMUST00000176860]
Predicted Effect probably null
Transcript: ENSMUST00000034308
SMART Domains Protein: ENSMUSP00000034308
Gene: ENSMUSG00000031845

DomainStartEndE-ValueType
Pfam:RPE65 5 519 9e-114 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167370
SMART Domains Protein: ENSMUSP00000132042
Gene: ENSMUSG00000031845

DomainStartEndE-ValueType
Pfam:RPE65 2 472 4.9e-117 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176860
SMART Domains Protein: ENSMUSP00000134815
Gene: ENSMUSG00000031845

DomainStartEndE-ValueType
Pfam:RPE65 2 472 4.9e-117 PFAM
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Vitamin A metabolism is important for vital processes such as vision, embryonic development, cell differentiation, and membrane and skin protection. The protein encoded by this gene is a key enzyme in beta-carotene metabolism to vitamin A. It catalyzes the oxidative cleavage of beta,beta-carotene into two retinal molecules. Two alternatively spliced variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a null mutation display fatty livers, elevated serum free fatty acid levels, increased susceptibility to diet-induced obesity, and impaired conversion of beta-carotene to vitamin A. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Bco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Bco1 APN 8 117130637 missense probably damaging 1.00
IGL01934:Bco1 APN 8 117096045 missense possibly damaging 0.90
IGL02182:Bco1 APN 8 117133066 missense probably damaging 1.00
IGL02375:Bco1 APN 8 117113439 missense probably benign 0.13
IGL02705:Bco1 APN 8 117117503 missense possibly damaging 0.95
H8562:Bco1 UTSW 8 117105647 splice site probably benign
R0453:Bco1 UTSW 8 117108777 missense possibly damaging 0.55
R0652:Bco1 UTSW 8 117105696 missense probably damaging 1.00
R1619:Bco1 UTSW 8 117108715 missense probably damaging 1.00
R1772:Bco1 UTSW 8 117130608 missense probably benign 0.03
R1827:Bco1 UTSW 8 117105759 missense probably damaging 1.00
R1834:Bco1 UTSW 8 117117437 missense probably benign 0.01
R2261:Bco1 UTSW 8 117133025 missense probably damaging 1.00
R2262:Bco1 UTSW 8 117133025 missense probably damaging 1.00
R2273:Bco1 UTSW 8 117108783 critical splice donor site probably null
R2274:Bco1 UTSW 8 117108783 critical splice donor site probably null
R3037:Bco1 UTSW 8 117127539 missense probably benign 0.00
R3792:Bco1 UTSW 8 117130676 missense possibly damaging 0.95
R3926:Bco1 UTSW 8 117127472 missense probably benign
R4193:Bco1 UTSW 8 117113469 missense probably damaging 1.00
R4661:Bco1 UTSW 8 117129241 missense probably benign 0.00
R4968:Bco1 UTSW 8 117131094 missense probably benign 0.00
R5523:Bco1 UTSW 8 117108693 missense possibly damaging 0.67
R6006:Bco1 UTSW 8 117113591 splice site probably null
R6174:Bco1 UTSW 8 117113534 missense probably damaging 0.97
R6458:Bco1 UTSW 8 117127506 missense possibly damaging 0.50
R6815:Bco1 UTSW 8 117113522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACGTATCACCTGCTTTATGC -3'
(R):5'- TCAGGTTGGCCAGGTAGAAG -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTATAATGGG -3'
(R):5'- AGAGCTGATAGAGGCTGCTGTC -3'
Posted On2016-07-22