Incidental Mutation 'R5277:Zfp7'
ID404020
Institutional Source Beutler Lab
Gene Symbol Zfp7
Ensembl Gene ENSMUSG00000033669
Gene Namezinc finger protein 7
SynonymsKRAB20, Zfp-7, Zfp86-rs1, Zfp65, Zfp80, KRAB7, Krox-2, mszf73-2
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5277 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76879259-76892395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76881203 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 32 (V32A)
Ref Sequence ENSEMBL: ENSMUSP00000155009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023179] [ENSMUST00000229831] [ENSMUST00000229990] [ENSMUST00000230106] [ENSMUST00000230214]
Predicted Effect probably benign
Transcript: ENSMUST00000023179
AA Change: V32A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023179
Gene: ENSMUSG00000033669
AA Change: V32A

DomainStartEndE-ValueType
KRAB 4 65 3.07e-33 SMART
ZnF_C2H2 192 214 6.88e-4 SMART
ZnF_C2H2 220 242 4.24e-4 SMART
ZnF_C2H2 248 270 2.09e-3 SMART
ZnF_C2H2 276 298 1.45e-2 SMART
ZnF_C2H2 304 326 1.13e-4 SMART
ZnF_C2H2 332 354 9.08e-4 SMART
ZnF_C2H2 360 383 2.24e-3 SMART
ZnF_C2H2 412 434 9.08e-4 SMART
ZnF_C2H2 440 462 1.67e-2 SMART
ZnF_C2H2 468 490 3.44e-4 SMART
ZnF_C2H2 496 518 8.47e-4 SMART
ZnF_C2H2 524 546 4.54e-4 SMART
ZnF_C2H2 552 574 7.9e-4 SMART
ZnF_C2H2 580 602 1.72e-4 SMART
ZnF_C2H2 633 655 1.98e-4 SMART
ZnF_C2H2 661 683 4.79e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229782
Predicted Effect probably damaging
Transcript: ENSMUST00000229831
AA Change: V32A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229990
AA Change: V32A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230106
AA Change: V32A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably damaging
Transcript: ENSMUST00000230214
AA Change: V32A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230954
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Other mutations in Zfp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp7 APN 15 76890901 intron probably benign
IGL01509:Zfp7 APN 15 76881133 missense probably damaging 1.00
IGL01694:Zfp7 APN 15 76890795 nonsense probably null
IGL01731:Zfp7 APN 15 76888305 nonsense probably null
IGL02025:Zfp7 APN 15 76888264 missense probably damaging 1.00
R0841:Zfp7 UTSW 15 76891504 missense probably damaging 1.00
R1345:Zfp7 UTSW 15 76890708 missense probably damaging 1.00
R1625:Zfp7 UTSW 15 76881174 missense probably damaging 1.00
R1872:Zfp7 UTSW 15 76891777 missense probably benign 0.00
R2330:Zfp7 UTSW 15 76891309 missense probably damaging 1.00
R4170:Zfp7 UTSW 15 76891618 missense probably benign 0.00
R4795:Zfp7 UTSW 15 76891346 nonsense probably null
R4796:Zfp7 UTSW 15 76891346 nonsense probably null
R5038:Zfp7 UTSW 15 76891810 missense probably benign 0.01
R5285:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5287:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5445:Zfp7 UTSW 15 76890854 nonsense probably null
R5655:Zfp7 UTSW 15 76891429 missense probably damaging 1.00
R6320:Zfp7 UTSW 15 76890610 missense possibly damaging 0.79
R7063:Zfp7 UTSW 15 76891719 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGAGCCAAAAGGATCCAGTC -3'
(R):5'- TGATGTGTGTAAAGCCTGGAGC -3'

Sequencing Primer
(F):5'- AGTCCTGCTGGAGGTATACCATAC -3'
(R):5'- GATTCAAGGTTTAGCCCCCAAGG -3'
Posted On2016-07-22