Incidental Mutation 'R5277:Fam13b'
ID404024
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Namefamily with sequence similarity 13, member B
Synonyms2610024E20Rik
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34442352-34506823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34462190 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 374 (R374C)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
Predicted Effect probably benign
Transcript: ENSMUST00000040506
AA Change: R374C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: R374C

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34487096 missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34454718 missense probably damaging 1.00
IGL00556:Fam13b APN 18 34497435 missense probably damaging 0.99
IGL02123:Fam13b APN 18 34445618 unclassified probably benign
IGL02313:Fam13b APN 18 34454656 missense probably damaging 1.00
IGL02346:Fam13b APN 18 34462105 missense probably benign 0.00
IGL02347:Fam13b APN 18 34454704 missense probably damaging 1.00
IGL02694:Fam13b APN 18 34451206 critical splice donor site probably null
IGL03347:Fam13b APN 18 34462051 splice site probably benign
R0109:Fam13b UTSW 18 34451308 missense probably benign 0.00
R0233:Fam13b UTSW 18 34448084 missense probably damaging 1.00
R0455:Fam13b UTSW 18 34445528 unclassified probably benign
R1229:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1397:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1571:Fam13b UTSW 18 34497432 missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34451439 critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34487134 missense probably benign 0.04
R1777:Fam13b UTSW 18 34457760 missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34445329 missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34494761 missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34462059 critical splice donor site probably null
R3896:Fam13b UTSW 18 34462955 splice site probably benign
R5759:Fam13b UTSW 18 34497435 missense probably damaging 0.99
R5817:Fam13b UTSW 18 34457797 missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34454081 missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34497405 missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34494774 missense probably damaging 1.00
R6087:Fam13b UTSW 18 34487139 missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34494277 missense probably damaging 0.96
R6454:Fam13b UTSW 18 34457662 critical splice donor site probably null
R6464:Fam13b UTSW 18 34473631 nonsense probably null
R6679:Fam13b UTSW 18 34487022 missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34498026 missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34497447 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGGCAAGCACTGTCCAGAG -3'
(R):5'- CCACTGTGTACAGATAAGTAGAAATGG -3'

Sequencing Primer
(F):5'- ACTGTCCAGAGGAGGGC -3'
(R):5'- GGACAGTTGGTTTTGTTGGGACAG -3'
Posted On2016-07-22