Incidental Mutation 'R5277:Ablim1'
ID404028
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Nameactin-binding LIM protein 1
Synonyms2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1
MMRRC Submission 042864-MU
Accession Numbers

Genbank: NM_178688; MGI: 1194500

Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location57032733-57314919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57155261 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 89 (R89G)
Ref Sequence ENSEMBL: ENSMUSP00000107183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000111524] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
Predicted Effect probably damaging
Transcript: ENSMUST00000079360
AA Change: R152G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085
AA Change: R152G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099294
AA Change: R76G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085
AA Change: R76G

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111524
AA Change: R75G

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107149
Gene: ENSMUSG00000025085
AA Change: R75G

DomainStartEndE-ValueType
LIM 21 72 1.14e-9 SMART
LIM 80 132 1.37e-12 SMART
LIM 148 199 1.12e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111544
AA Change: R76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085
AA Change: R76G

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111546
AA Change: R76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085
AA Change: R76G

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111550
AA Change: R76G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085
AA Change: R76G

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111555
AA Change: R152G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085
AA Change: R152G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111558
AA Change: R89G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085
AA Change: R89G

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111559
AA Change: R89G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085
AA Change: R89G

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000133369
AA Change: R98G
SMART Domains Protein: ENSMUSP00000117798
Gene: ENSMUSG00000025085
AA Change: R98G

DomainStartEndE-ValueType
LIM 45 96 1.14e-9 SMART
LIM 104 156 1.37e-12 SMART
LIM 172 223 1.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156316
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57152290 missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57061328 missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57215721 missense probably benign
IGL01385:Ablim1 APN 19 57068914 missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57039447 missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57134654 missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57079880 splice site probably benign
IGL02498:Ablim1 APN 19 57152319 nonsense probably null
A9681:Ablim1 UTSW 19 57173323 critical splice donor site probably null
R0089:Ablim1 UTSW 19 57043031 missense probably damaging 1.00
R0226:Ablim1 UTSW 19 57043870 missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57134633 missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57068236 missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57215965 start gained probably null
R1936:Ablim1 UTSW 19 57215965 start gained probably null
R2021:Ablim1 UTSW 19 57047018 missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57043813 missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57077431 missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57152359 missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57152303 missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3733:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3734:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3878:Ablim1 UTSW 19 57037210 utr 3 prime probably null
R4354:Ablim1 UTSW 19 57155278 missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57077442 missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57215721 missense probably benign
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R5331:Ablim1 UTSW 19 57155249 missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57130923 missense probably benign 0.07
R5893:Ablim1 UTSW 19 57215853 missense probably benign 0.07
R5958:Ablim1 UTSW 19 57041935 missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57061355 missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57079839 missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57130852 missense probably benign 0.03
R6662:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R6705:Ablim1 UTSW 19 57215821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGACTCTGTACTGTTCAGGACC -3'
(R):5'- TGTCCCCAAACCGTTGAGAG -3'

Sequencing Primer
(F):5'- CTCTGTACTGTTCAGGACCAGAGG -3'
(R):5'- CCAAACCGTTGAGAGCACAGG -3'
Posted On2016-07-22