Incidental Mutation 'R5279:Psmc3'
ID404087
Institutional Source Beutler Lab
Gene Symbol Psmc3
Ensembl Gene ENSMUSG00000002102
Gene Nameproteasome (prosome, macropain) 26S subunit, ATPase 3
SynonymsTat binding protein 1, TBP-1
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5279 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91054009-91066369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91054322 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 6 (D6E)
Ref Sequence ENSEMBL: ENSMUSP00000139782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002171] [ENSMUST00000067663] [ENSMUST00000111441] [ENSMUST00000185715]
Predicted Effect probably benign
Transcript: ENSMUST00000002171
AA Change: D25E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002171
Gene: ENSMUSG00000002102
AA Change: D25E

DomainStartEndE-ValueType
AAA 222 361 6.65e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067663
AA Change: D25E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071054
Gene: ENSMUSG00000002102
AA Change: D25E

DomainStartEndE-ValueType
AAA 222 361 6.65e-22 SMART
Blast:AAA 390 436 9e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111441
AA Change: D25E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107068
Gene: ENSMUSG00000002102
AA Change: D25E

DomainStartEndE-ValueType
AAA 180 319 6.65e-22 SMART
Blast:AAA 348 394 8e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145317
Predicted Effect unknown
Transcript: ENSMUST00000146506
AA Change: D7E
SMART Domains Protein: ENSMUSP00000121688
Gene: ENSMUSG00000002102
AA Change: D7E

DomainStartEndE-ValueType
PDB:4CR4|M 13 183 2e-69 PDB
Blast:AAA 140 183 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152269
Predicted Effect probably benign
Transcript: ENSMUST00000185715
AA Change: D6E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139782
Gene: ENSMUSG00000002102
AA Change: D6E

DomainStartEndE-ValueType
AAA 203 301 9e-14 SMART
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Carmil3 A G 14: 55,501,571 D894G probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 probably benign Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pdia3 T C 2: 121,414,003 probably benign Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Pklr A G 3: 89,143,259 E409G probably damaging Het
Plod2 T C 9: 92,581,323 Y154H probably damaging Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Sdk2 A G 11: 113,867,031 M519T probably benign Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Tyw3 A G 3: 154,594,471 C80R probably damaging Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Wrn A G 8: 33,241,101 Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Psmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0370:Psmc3 UTSW 2 91055118 splice site probably null
R0747:Psmc3 UTSW 2 91054300 missense probably benign 0.10
R1182:Psmc3 UTSW 2 91056035 missense probably damaging 1.00
R1763:Psmc3 UTSW 2 91055995 missense possibly damaging 0.81
R1967:Psmc3 UTSW 2 91057844 missense probably benign 0.19
R2056:Psmc3 UTSW 2 91058088 missense probably benign 0.40
R2484:Psmc3 UTSW 2 91056001 missense probably damaging 0.97
R3411:Psmc3 UTSW 2 91055918 missense probably damaging 1.00
R3608:Psmc3 UTSW 2 91054580 missense probably benign 0.00
R4917:Psmc3 UTSW 2 91065972 unclassified probably benign
R4954:Psmc3 UTSW 2 91055629 intron probably benign
R5033:Psmc3 UTSW 2 91054608 missense probably benign 0.03
R5073:Psmc3 UTSW 2 91054570 splice site probably benign
R5354:Psmc3 UTSW 2 91059353 missense probably damaging 1.00
R6169:Psmc3 UTSW 2 91057839 missense probably damaging 1.00
R6224:Psmc3 UTSW 2 91054630 missense probably damaging 1.00
R7039:Psmc3 UTSW 2 91055046 missense probably benign 0.32
R7275:Psmc3 UTSW 2 91055930 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAATCGCGGGTGAAGTTCTC -3'
(R):5'- ATTTACTGTAACTCAGAGCTGCC -3'

Sequencing Primer
(F):5'- GGTGAAGTTCTCCACGGG -3'
(R):5'- TGTAACTCAGAGCTGCCATCCC -3'
Posted On2016-07-22