Incidental Mutation 'R5279:Pklr'
ID404093
Institutional Source Beutler Lab
Gene Symbol Pklr
Ensembl Gene ENSMUSG00000041237
Gene Namepyruvate kinase liver and red blood cell
SynonymsPk1, R-PK, Pk-1
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R5279 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89136142-89146784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89143259 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 409 (E409G)
Ref Sequence ENSEMBL: ENSMUSP00000103106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029686] [ENSMUST00000047111] [ENSMUST00000107482] [ENSMUST00000127058]
Predicted Effect probably benign
Transcript: ENSMUST00000029686
SMART Domains Protein: ENSMUSP00000029686
Gene: ENSMUSG00000028051

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
Pfam:Ion_trans_N 48 91 1.3e-22 PFAM
Pfam:Ion_trans 92 357 3.7e-25 PFAM
low complexity region 358 369 N/A INTRINSIC
Blast:cNMP 370 402 7e-14 BLAST
cNMP 427 540 2.32e-20 SMART
Blast:cNMP 548 588 2e-17 BLAST
low complexity region 636 656 N/A INTRINSIC
low complexity region 698 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047111
AA Change: E440G

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035417
Gene: ENSMUSG00000041237
AA Change: E440G

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:PK 85 438 6.9e-165 PFAM
Pfam:PK_C 453 571 3.6e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107482
AA Change: E409G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103106
Gene: ENSMUSG00000041237
AA Change: E409G

DomainStartEndE-ValueType
Pfam:PK 54 407 3.1e-163 PFAM
Pfam:PK_C 421 541 4.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127058
SMART Domains Protein: ENSMUSP00000119392
Gene: ENSMUSG00000041237

DomainStartEndE-ValueType
Pfam:PK 21 72 7.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148097
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyruvate kinase that catalyzes the transphosphorylation of phohsphoenolpyruvate into pyruvate and ATP, which is the rate-limiting step of glycolysis. Defects in this enzyme, due to gene mutations or genetic variations, are the common cause of chronic hereditary nonspherocytic hemolytic anemia (CNSHA or HNSHA). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for loss of function mutations in this gene suffer from hemolytic anemia. This is also a candidate gene for malaria resistance QTL Char4 and immunity to Salmonella typhimurium QTL Ity4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Carmil3 A G 14: 55,501,571 D894G probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 probably benign Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pdia3 T C 2: 121,414,003 probably benign Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Plod2 T C 9: 92,581,323 Y154H probably damaging Het
Psmc3 T A 2: 91,054,322 D6E probably benign Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Sdk2 A G 11: 113,867,031 M519T probably benign Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Tyw3 A G 3: 154,594,471 C80R probably damaging Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Wrn A G 8: 33,241,101 Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Pklr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Pklr APN 3 89144995 missense probably damaging 1.00
IGL02108:Pklr APN 3 89137403 missense probably damaging 1.00
IGL03030:Pklr APN 3 89142656 missense probably damaging 1.00
IGL03401:Pklr APN 3 89142729 missense probably benign 0.41
R0088:Pklr UTSW 3 89141908 missense probably damaging 1.00
R0801:Pklr UTSW 3 89145522 nonsense probably null
R1061:Pklr UTSW 3 89144881 missense probably damaging 1.00
R1434:Pklr UTSW 3 89143035 missense probably damaging 1.00
R2030:Pklr UTSW 3 89143238 missense probably damaging 1.00
R2131:Pklr UTSW 3 89142660 missense probably damaging 1.00
R3703:Pklr UTSW 3 89142701 missense probably damaging 1.00
R4372:Pklr UTSW 3 89145523 nonsense probably null
R5401:Pklr UTSW 3 89141866 missense probably damaging 1.00
R5809:Pklr UTSW 3 89141784 missense probably benign
R5946:Pklr UTSW 3 89136196 missense probably benign 0.43
R6331:Pklr UTSW 3 89137355 missense probably damaging 0.99
R7559:Pklr UTSW 3 89143058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGGAGGCTGTAAAGATGC -3'
(R):5'- GCCTCTAGAGTCCATAGCTATCCC -3'

Sequencing Primer
(F):5'- CAACATGCGGTAGGAACTCAGTC -3'
(R):5'- AGAGTCCATAGCTATCCCTTTTC -3'
Posted On2016-07-22