Incidental Mutation 'R5279:Kat6a'
ID404110
Institutional Source Beutler Lab
Gene Symbol Kat6a
Ensembl Gene ENSMUSG00000031540
Gene NameK(lysine) acetyltransferase 6A
SynonymsZfp220, MOZ, 9930021N24Rik, Myst3
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5279 (G1)
Quality Score214
Status Not validated
Chromosome8
Chromosomal Location22859535-22943259 bp(+) (GRCm38)
Type of Mutationsmall deletion (2 aa in frame mutation)
DNA Base Change (assembly) CGCAGCAGCAGCAGCAGCA to CGCAGCAGCAGCA at 22939648 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044331] [ENSMUST00000110696]
Predicted Effect probably benign
Transcript: ENSMUST00000044331
SMART Domains Protein: ENSMUSP00000038181
Gene: ENSMUSG00000031540

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 561 748 5.9e-92 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110696
SMART Domains Protein: ENSMUSP00000106324
Gene: ENSMUSG00000031540

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 564 742 2.9e-85 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MOZ, YBFR2, SAS2, TIP60 family of histone acetyltransferases. The protein is composed of a nuclear localization domain, a double C2H2 zinc finger domain that binds to acetylated histone tails, a histone acetyl-transferase domain, a glutamate/aspartate-rich region, and a serine- and methionine-rich transactivation domain. It is part of a complex that acetylates lysine-9 residues in histone 3, and in addition, it acts as a co-activator for several transcription factors. Allelic variants of this gene are associated with autosomal dominant mental retardation-32. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display perinatal lethality, cyanosis, decreased hematopoietic progenitor cell numbers, and severely impaired spleen and thymus development, but are not anemic. Heterozygotes display strain background dependent reductions in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Carmil3 A G 14: 55,501,571 D894G probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pdia3 T C 2: 121,414,003 probably benign Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Pklr A G 3: 89,143,259 E409G probably damaging Het
Plod2 T C 9: 92,581,323 Y154H probably damaging Het
Psmc3 T A 2: 91,054,322 D6E probably benign Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Sdk2 A G 11: 113,867,031 M519T probably benign Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Tyw3 A G 3: 154,594,471 C80R probably damaging Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Wrn A G 8: 33,241,101 Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Kat6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Kat6a APN 8 22940263 missense unknown
IGL01093:Kat6a APN 8 22939321 missense possibly damaging 0.85
IGL01364:Kat6a APN 8 22907700 missense probably damaging 1.00
IGL01868:Kat6a APN 8 22926455 missense probably damaging 1.00
IGL02477:Kat6a APN 8 22929300 missense probably damaging 1.00
IGL02792:Kat6a APN 8 22938300 missense probably damaging 0.98
IGL03243:Kat6a APN 8 22910222 missense possibly damaging 0.77
Anning UTSW 8 22932113 critical splice acceptor site probably null
lord UTSW 8 22862364 missense probably damaging 1.00
master UTSW 8 22862788 missense probably damaging 0.99
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0284:Kat6a UTSW 8 22939803 missense unknown
R0636:Kat6a UTSW 8 22939323 missense possibly damaging 0.73
R0883:Kat6a UTSW 8 22862214 missense probably damaging 1.00
R1457:Kat6a UTSW 8 22938652 missense probably benign
R1753:Kat6a UTSW 8 22935797 missense probably benign 0.09
R2059:Kat6a UTSW 8 22939305 missense possibly damaging 0.53
R2155:Kat6a UTSW 8 22935647 small deletion probably benign
R2764:Kat6a UTSW 8 22932178 missense probably damaging 1.00
R3724:Kat6a UTSW 8 22862788 missense probably damaging 0.99
R3824:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R3825:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R4370:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4371:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4457:Kat6a UTSW 8 22932113 critical splice acceptor site probably null
R4600:Kat6a UTSW 8 22939311 missense probably benign 0.18
R4792:Kat6a UTSW 8 22940576 missense unknown
R4896:Kat6a UTSW 8 22938313 missense probably benign 0.07
R5069:Kat6a UTSW 8 22903133 missense probably damaging 1.00
R5192:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5196:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5331:Kat6a UTSW 8 22939984 missense unknown
R5480:Kat6a UTSW 8 22938307 missense possibly damaging 0.77
R5659:Kat6a UTSW 8 22938160 nonsense probably null
R5759:Kat6a UTSW 8 22938012 missense probably benign 0.04
R5787:Kat6a UTSW 8 22932647 missense probably damaging 0.99
R5892:Kat6a UTSW 8 22938289 missense probably damaging 1.00
R5923:Kat6a UTSW 8 22939479 missense probably benign 0.00
R6049:Kat6a UTSW 8 22939037 missense possibly damaging 0.53
R6223:Kat6a UTSW 8 22940426 missense unknown
R6276:Kat6a UTSW 8 22939405 missense possibly damaging 0.96
R6279:Kat6a UTSW 8 22939612 missense unknown
R6300:Kat6a UTSW 8 22939612 missense unknown
R6307:Kat6a UTSW 8 22940368 missense unknown
R6562:Kat6a UTSW 8 22911787 missense probably benign 0.04
R6807:Kat6a UTSW 8 22940368 missense unknown
R6852:Kat6a UTSW 8 22938660 missense probably benign 0.18
R6875:Kat6a UTSW 8 22932361 missense probably benign 0.02
R6895:Kat6a UTSW 8 22935783 missense possibly damaging 0.88
R6913:Kat6a UTSW 8 22903199 missense possibly damaging 0.53
R7047:Kat6a UTSW 8 22938538 missense possibly damaging 0.53
R7235:Kat6a UTSW 8 22914269 missense possibly damaging 0.94
R7243:Kat6a UTSW 8 22938775 missense probably benign 0.00
X0050:Kat6a UTSW 8 22940481 nonsense probably null
Z1088:Kat6a UTSW 8 22935501 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCAAATGGCCAACATGGG -3'
(R):5'- AAATCCCCTGGAATCCTCTCG -3'

Sequencing Primer
(F):5'- AACAGCTGCAGCATGCTG -3'
(R):5'- CGTAGATACTGATATTCCCAGTGC -3'
Posted On2016-07-22