Incidental Mutation 'R5279:Wrn'
ID404111
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene NameWerner syndrome RecQ like helicase
Synonyms
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R5279 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location33234384-33385527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33241101 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1068 (Y1068H)
Ref Sequence ENSEMBL: ENSMUSP00000147379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]
Predicted Effect probably damaging
Transcript: ENSMUST00000033990
AA Change: Y1311H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: Y1311H

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000033991
AA Change: Y1311H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: Y1311H

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211498
AA Change: Y1068H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Carmil3 A G 14: 55,501,571 D894G probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 probably benign Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pdia3 T C 2: 121,414,003 probably benign Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Pklr A G 3: 89,143,259 E409G probably damaging Het
Plod2 T C 9: 92,581,323 Y154H probably damaging Het
Psmc3 T A 2: 91,054,322 D6E probably benign Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Sdk2 A G 11: 113,867,031 M519T probably benign Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Tyw3 A G 3: 154,594,471 C80R probably damaging Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33322377 splice site probably benign
IGL00661:Wrn APN 8 33319145 splice site probably benign
IGL01472:Wrn APN 8 33329172 missense possibly damaging 0.93
IGL01544:Wrn APN 8 33324526 missense probably benign 0.00
IGL01599:Wrn APN 8 33241011 missense possibly damaging 0.69
IGL01688:Wrn APN 8 33310702 splice site probably benign
IGL01916:Wrn APN 8 33257224 missense possibly damaging 0.78
IGL01925:Wrn APN 8 33319180 missense probably benign 0.42
IGL02068:Wrn APN 8 33310749 missense probably benign 0.38
IGL02084:Wrn APN 8 33285179 missense probably benign
IGL02167:Wrn APN 8 33317555 missense probably damaging 1.00
IGL02230:Wrn APN 8 33317563 missense probably damaging 1.00
IGL02717:Wrn APN 8 33343573 missense probably damaging 1.00
IGL02982:Wrn APN 8 33343066 missense probably damaging 1.00
IGL03030:Wrn APN 8 33248961 missense possibly damaging 0.94
IGL03088:Wrn APN 8 33268823 splice site probably benign
IGL03179:Wrn APN 8 33310706 splice site probably null
IGL03306:Wrn APN 8 33336121 missense probably damaging 1.00
R0004:Wrn UTSW 8 33317560 missense probably damaging 1.00
R0190:Wrn UTSW 8 33240983 missense probably benign 0.02
R0441:Wrn UTSW 8 33268750 missense probably benign 0.24
R0463:Wrn UTSW 8 33280815 missense possibly damaging 0.84
R0538:Wrn UTSW 8 33336091 missense probably damaging 0.99
R0682:Wrn UTSW 8 33267820 missense probably benign 0.00
R0729:Wrn UTSW 8 33248918 splice site probably null
R0744:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R0836:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R1168:Wrn UTSW 8 33316408 missense probably damaging 1.00
R1301:Wrn UTSW 8 33292686 missense probably damaging 1.00
R1352:Wrn UTSW 8 33294916 missense probably benign 0.25
R1396:Wrn UTSW 8 33268819 missense probably damaging 1.00
R1432:Wrn UTSW 8 33319141 splice site probably benign
R1523:Wrn UTSW 8 33292716 missense probably benign 0.23
R1625:Wrn UTSW 8 33329130 missense probably benign 0.01
R1664:Wrn UTSW 8 33280766 splice site probably null
R1773:Wrn UTSW 8 33343561 missense probably damaging 1.00
R1864:Wrn UTSW 8 33288864 missense probably damaging 0.99
R1868:Wrn UTSW 8 33257221 missense probably benign 0.03
R2011:Wrn UTSW 8 33236404 missense probably benign 0.02
R2075:Wrn UTSW 8 33322329 missense probably benign 0.00
R2091:Wrn UTSW 8 33267825 missense probably benign
R2213:Wrn UTSW 8 33257015 missense probably benign 0.05
R2255:Wrn UTSW 8 33329202 missense probably benign 0.13
R2276:Wrn UTSW 8 33324556 missense probably benign 0.02
R3177:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3277:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3779:Wrn UTSW 8 33241020 missense probably damaging 1.00
R3827:Wrn UTSW 8 33324520 missense probably benign 0.00
R4111:Wrn UTSW 8 33352155 missense probably benign 0.02
R4392:Wrn UTSW 8 33251832 missense probably damaging 0.99
R4458:Wrn UTSW 8 33294998 missense probably damaging 0.99
R4650:Wrn UTSW 8 33255509 missense probably benign 0.05
R4656:Wrn UTSW 8 33335991 splice site probably null
R4657:Wrn UTSW 8 33335991 splice site probably null
R4667:Wrn UTSW 8 33324338 missense probably benign 0.00
R4735:Wrn UTSW 8 33285222 missense probably damaging 1.00
R4933:Wrn UTSW 8 33322343 missense probably benign 0.01
R5104:Wrn UTSW 8 33267867 splice site probably null
R5166:Wrn UTSW 8 33352072 critical splice donor site probably null
R5400:Wrn UTSW 8 33294917 missense probably benign 0.02
R5575:Wrn UTSW 8 33336130 missense probably benign 0.02
R5695:Wrn UTSW 8 33324318 missense probably benign 0.26
R5729:Wrn UTSW 8 33268778 missense probably benign 0.02
R6044:Wrn UTSW 8 33236429 missense probably damaging 1.00
R6139:Wrn UTSW 8 33353332 missense probably damaging 1.00
R6158:Wrn UTSW 8 33319172 missense probably damaging 1.00
R6192:Wrn UTSW 8 33284654 missense probably benign 0.12
R6243:Wrn UTSW 8 33284654 missense possibly damaging 0.94
R6354:Wrn UTSW 8 33343638 missense possibly damaging 0.93
R6429:Wrn UTSW 8 33342996 missense probably damaging 1.00
R6490:Wrn UTSW 8 33319220 missense probably benign 0.01
R6529:Wrn UTSW 8 33335976 intron probably null
R6535:Wrn UTSW 8 33336103 missense probably damaging 0.99
R7001:Wrn UTSW 8 33352129 missense probably benign 0.04
R7114:Wrn UTSW 8 33285121 frame shift probably null
R7198:Wrn UTSW 8 33324318 missense probably benign 0.00
R7200:Wrn UTSW 8 33322348 missense probably benign 0.00
R7227:Wrn UTSW 8 33248946 missense probably damaging 1.00
R7299:Wrn UTSW 8 33292718 missense probably damaging 1.00
R7374:Wrn UTSW 8 33268911 missense probably damaging 1.00
R7402:Wrn UTSW 8 33248966 missense probably benign 0.00
R7404:Wrn UTSW 8 33248966 missense probably benign 0.00
R7405:Wrn UTSW 8 33248966 missense probably benign 0.00
R7464:Wrn UTSW 8 33335996 critical splice donor site probably null
R7474:Wrn UTSW 8 33329181 missense probably damaging 0.96
X0017:Wrn UTSW 8 33280782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCACATGTGACACTTCG -3'
(R):5'- ACCCCATTTTCTCTTAGGGATG -3'

Sequencing Primer
(F):5'- TGTGACACTTCGCAAGCATG -3'
(R):5'- GGGATGTTACCATTTGAAAAACAGG -3'
Posted On2016-07-22