Incidental Mutation 'R5279:Sdk2'
ID404130
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Namesidekick cell adhesion molecule 2
Synonyms5330435L01Rik, 4632412F08Rik
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5279 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location113776374-114067046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113867031 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 519 (M519T)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627] [ENSMUST00000141943]
Predicted Effect probably benign
Transcript: ENSMUST00000041627
AA Change: M519T

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: M519T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141943
AA Change: M519T

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116872
Gene: ENSMUSG00000041592
AA Change: M519T

DomainStartEndE-ValueType
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 889 1.96e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155651
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Carmil3 A G 14: 55,501,571 D894G probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 probably benign Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pdia3 T C 2: 121,414,003 probably benign Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Pklr A G 3: 89,143,259 E409G probably damaging Het
Plod2 T C 9: 92,581,323 Y154H probably damaging Het
Psmc3 T A 2: 91,054,322 D6E probably benign Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Tyw3 A G 3: 154,594,471 C80R probably damaging Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Wrn A G 8: 33,241,101 Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTCTGCATCAACACGG -3'
(R):5'- ATGAGGTCATCGCTCAACATC -3'

Sequencing Primer
(F):5'- GTTCACACAGCATGGTCCTTAGG -3'
(R):5'- ATCTCCCAGCATCCAGATGTG -3'
Posted On2016-07-22