Incidental Mutation 'R5279:Carmil3'
ID404135
Institutional Source Beutler Lab
Gene Symbol Carmil3
Ensembl Gene ENSMUSG00000022211
Gene Namecapping protein regulator and myosin 1 linker 3
SynonymsLrrc16b
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R5279 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55490651-55508272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55501571 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 894 (D894G)
Ref Sequence ENSEMBL: ENSMUSP00000075587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]
Predicted Effect probably damaging
Transcript: ENSMUST00000076236
AA Change: D894G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211
AA Change: D894G

DomainStartEndE-ValueType
low complexity region 138 151 N/A INTRINSIC
internal_repeat_1 203 297 7.56e-6 PROSPERO
Blast:LRR 333 362 5e-10 BLAST
Blast:LRR 423 446 1e-5 BLAST
low complexity region 447 462 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
internal_repeat_1 496 593 7.56e-6 PROSPERO
Pfam:CARMIL_C 778 1065 5.3e-76 PFAM
low complexity region 1068 1117 N/A INTRINSIC
low complexity region 1137 1146 N/A INTRINSIC
low complexity region 1204 1216 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226388
Predicted Effect probably benign
Transcript: ENSMUST00000226446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226653
Predicted Effect probably benign
Transcript: ENSMUST00000226757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228760
Predicted Effect probably benign
Transcript: ENSMUST00000228877
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 probably benign Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pdia3 T C 2: 121,414,003 probably benign Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Pklr A G 3: 89,143,259 E409G probably damaging Het
Plod2 T C 9: 92,581,323 Y154H probably damaging Het
Psmc3 T A 2: 91,054,322 D6E probably benign Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Sdk2 A G 11: 113,867,031 M519T probably benign Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Tyw3 A G 3: 154,594,471 C80R probably damaging Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Wrn A G 8: 33,241,101 Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Carmil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Carmil3 APN 14 55498298 missense probably damaging 0.99
IGL00498:Carmil3 APN 14 55501895 critical splice donor site probably null
IGL01061:Carmil3 APN 14 55498630 missense possibly damaging 0.67
IGL01452:Carmil3 APN 14 55496058 missense probably damaging 0.99
IGL01606:Carmil3 APN 14 55493849 missense possibly damaging 0.83
IGL01633:Carmil3 APN 14 55494227 missense possibly damaging 0.84
IGL01977:Carmil3 APN 14 55493536 missense probably damaging 1.00
IGL02065:Carmil3 APN 14 55493822 splice site probably benign
IGL02160:Carmil3 APN 14 55493558 missense possibly damaging 0.70
IGL02491:Carmil3 APN 14 55504517 missense probably benign 0.00
IGL02567:Carmil3 APN 14 55498882 missense possibly damaging 0.93
IGL02629:Carmil3 APN 14 55499068 missense probably damaging 0.97
IGL02720:Carmil3 APN 14 55507410 missense probably damaging 0.97
IGL03100:Carmil3 APN 14 55494718 missense probably damaging 0.99
R0023:Carmil3 UTSW 14 55492876 missense probably damaging 1.00
R0023:Carmil3 UTSW 14 55492876 missense probably damaging 1.00
R0027:Carmil3 UTSW 14 55494403 missense probably damaging 0.96
R0101:Carmil3 UTSW 14 55497755 splice site probably benign
R0321:Carmil3 UTSW 14 55502241 missense possibly damaging 0.63
R0370:Carmil3 UTSW 14 55495442 missense possibly damaging 0.82
R0465:Carmil3 UTSW 14 55499861 missense probably damaging 0.99
R0647:Carmil3 UTSW 14 55502435 critical splice donor site probably null
R1503:Carmil3 UTSW 14 55498280 missense probably damaging 0.96
R1635:Carmil3 UTSW 14 55496282 missense possibly damaging 0.91
R1715:Carmil3 UTSW 14 55504532 missense probably benign 0.02
R1923:Carmil3 UTSW 14 55502404 missense probably damaging 0.99
R1944:Carmil3 UTSW 14 55498630 missense probably damaging 0.97
R2513:Carmil3 UTSW 14 55503838 missense probably damaging 0.98
R2892:Carmil3 UTSW 14 55498313 missense probably damaging 0.96
R3433:Carmil3 UTSW 14 55507694 missense probably benign 0.05
R3552:Carmil3 UTSW 14 55507402 missense possibly damaging 0.86
R3783:Carmil3 UTSW 14 55496976 missense probably damaging 1.00
R3787:Carmil3 UTSW 14 55496976 missense probably damaging 1.00
R4181:Carmil3 UTSW 14 55503955 missense probably benign 0.10
R4285:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4420:Carmil3 UTSW 14 55493588 missense probably damaging 0.98
R4424:Carmil3 UTSW 14 55501471 missense probably benign
R4506:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4507:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4534:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4535:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4549:Carmil3 UTSW 14 55505664 splice site probably null
R4574:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4783:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R4784:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R5146:Carmil3 UTSW 14 55497179 missense probably benign 0.02
R5425:Carmil3 UTSW 14 55493877 missense probably benign 0.41
R5530:Carmil3 UTSW 14 55493624 missense probably damaging 0.98
R5534:Carmil3 UTSW 14 55494890 missense probably damaging 0.97
R5598:Carmil3 UTSW 14 55503999 frame shift probably null
R5772:Carmil3 UTSW 14 55493239 missense probably damaging 1.00
R5896:Carmil3 UTSW 14 55503999 frame shift probably null
R5931:Carmil3 UTSW 14 55498940 missense probably damaging 0.99
R6048:Carmil3 UTSW 14 55503845 missense probably benign 0.00
R6103:Carmil3 UTSW 14 55505427 missense probably benign 0.02
R6258:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6260:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6338:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6339:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6646:Carmil3 UTSW 14 55507930 missense probably damaging 0.97
R6936:Carmil3 UTSW 14 55501561 missense probably benign 0.04
U24488:Carmil3 UTSW 14 55497179 missense probably benign 0.02
Z1088:Carmil3 UTSW 14 55501568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGATCAGGGAAGTCAG -3'
(R):5'- TGTCCTGCAGAAACGGAGAC -3'

Sequencing Primer
(F):5'- ATCAGGGAAGTCAGCACGTTCC -3'
(R):5'- AGACCCTCAAAGCCTTTTCTTTAGAG -3'
Posted On2016-07-22