Incidental Mutation 'R5280:Wdr7'
ID404182
Institutional Source Beutler Lab
Gene Symbol Wdr7
Ensembl Gene ENSMUSG00000040560
Gene NameWD repeat domain 7
SynonymsTGF-beta resistance associated gene, TRAG
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location63708695-63989760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63987312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1475 (V1475F)
Ref Sequence ENSEMBL: ENSMUSP00000072509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072726]
Predicted Effect probably benign
Transcript: ENSMUST00000072726
AA Change: V1475F

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: V1475F

DomainStartEndE-ValueType
WD40 5 47 1.2e-2 SMART
WD40 53 95 3.71e-1 SMART
Blast:WD40 145 190 1e-18 BLAST
WD40 208 242 1.77e2 SMART
WD40 453 498 3.81e-5 SMART
WD40 501 546 4.26e1 SMART
WD40 549 588 1.63e-4 SMART
low complexity region 760 777 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
low complexity region 956 970 N/A INTRINSIC
low complexity region 1020 1040 N/A INTRINSIC
low complexity region 1181 1192 N/A INTRINSIC
Blast:WD40 1341 1380 5e-20 BLAST
WD40 1382 1422 2.73e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Wdr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Wdr7 APN 18 63720775 missense possibly damaging 0.83
IGL00708:Wdr7 APN 18 63778033 missense probably benign 0.42
IGL00813:Wdr7 APN 18 63735604 missense possibly damaging 0.84
IGL00840:Wdr7 APN 18 63927327 missense possibly damaging 0.80
IGL00904:Wdr7 APN 18 63796231 missense probably benign 0.43
IGL00930:Wdr7 APN 18 63740244 nonsense probably null
IGL01481:Wdr7 APN 18 63739179 missense probably damaging 1.00
IGL02121:Wdr7 APN 18 63777545 nonsense probably null
IGL02346:Wdr7 APN 18 63865336 missense probably benign 0.09
IGL02454:Wdr7 APN 18 63796228 missense probably benign 0.20
IGL02538:Wdr7 APN 18 63796235 missense probably benign 0.01
IGL02870:Wdr7 APN 18 63791843 missense probably benign
IGL03054:Wdr7 APN 18 63825121 splice site probably benign
IGL03189:Wdr7 APN 18 63760601 missense probably benign 0.17
R0014:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0022:Wdr7 UTSW 18 63777634 missense probably damaging 1.00
R0233:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0432:Wdr7 UTSW 18 63796249 missense probably damaging 0.96
R0496:Wdr7 UTSW 18 63791843 missense probably benign
R0633:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R0931:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R1585:Wdr7 UTSW 18 63924918 missense probably benign 0.03
R1651:Wdr7 UTSW 18 63720776 nonsense probably null
R1804:Wdr7 UTSW 18 63865440 missense probably damaging 1.00
R1874:Wdr7 UTSW 18 63728504 missense probably benign 0.02
R1985:Wdr7 UTSW 18 63760583 frame shift probably null
R2106:Wdr7 UTSW 18 63778038 missense probably damaging 1.00
R2206:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2207:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2245:Wdr7 UTSW 18 63924909 missense possibly damaging 0.60
R2407:Wdr7 UTSW 18 63760723 missense probably benign
R3804:Wdr7 UTSW 18 63720836 missense probably benign
R3880:Wdr7 UTSW 18 63724155 missense possibly damaging 0.92
R4410:Wdr7 UTSW 18 63778249 missense probably damaging 1.00
R4441:Wdr7 UTSW 18 63755210 missense probably damaging 1.00
R4485:Wdr7 UTSW 18 63777550 missense possibly damaging 0.89
R4606:Wdr7 UTSW 18 63779945 nonsense probably null
R4607:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4608:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4711:Wdr7 UTSW 18 63728465 missense probably benign
R4852:Wdr7 UTSW 18 63777949 missense probably damaging 0.98
R5197:Wdr7 UTSW 18 63738866 missense probably benign 0.02
R5213:Wdr7 UTSW 18 63755126 missense probably damaging 1.00
R5378:Wdr7 UTSW 18 63825239 critical splice donor site probably null
R6076:Wdr7 UTSW 18 63739277 missense probably damaging 1.00
R6083:Wdr7 UTSW 18 63728469 missense probably damaging 1.00
R6168:Wdr7 UTSW 18 63777977 missense probably damaging 0.98
R6234:Wdr7 UTSW 18 63724132 missense probably damaging 1.00
R6295:Wdr7 UTSW 18 63755111 missense probably damaging 1.00
R6548:Wdr7 UTSW 18 63778251 missense possibly damaging 0.87
R6566:Wdr7 UTSW 18 63755055 missense possibly damaging 0.72
R6696:Wdr7 UTSW 18 63739330 missense probably benign 0.07
R6937:Wdr7 UTSW 18 63791867 missense probably benign
R6962:Wdr7 UTSW 18 63865288 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGTCCCTGCAGATGAACAC -3'
(R):5'- CTTTCAATCGACAGGCTGCC -3'

Sequencing Primer
(F):5'- ACCTCACTCCTGGGAAGCATTG -3'
(R):5'- ATGTGGAATCTGCCCCCATGAAG -3'
Posted On2016-07-22