Incidental Mutation 'R5301:Vmn2r96'
ID404269
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Namevomeronasal 2, receptor 96
SynonymsEG433070
MMRRC Submission 042884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5301 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18573151-18616003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18597688 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 701 (I701N)
Ref Sequence ENSEMBL: ENSMUSP00000156012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
Predicted Effect probably damaging
Transcript: ENSMUST00000165692
AA Change: I509N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: I509N

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177244
AA Change: I701N

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: I701N

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect probably damaging
Transcript: ENSMUST00000231286
AA Change: I701N

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (52/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,102,853 V578A probably damaging Het
Abcb11 T C 2: 69,286,847 I486V probably damaging Het
Abcc9 G A 6: 142,590,481 T1509I probably benign Het
Akr1c20 T A 13: 4,523,280 D12V probably damaging Het
Asb1 A G 1: 91,554,753 Y66C probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Bcl10 A G 3: 145,930,587 D80G probably damaging Het
Bdnf T C 2: 109,723,539 V46A probably benign Het
Cyp11a1 A G 9: 58,019,261 probably benign Het
Cyp3a44 A G 5: 145,788,516 S292P probably damaging Het
Desi2 A G 1: 178,244,386 I85M probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock10 T C 1: 80,648,256 D49G probably benign Het
Epcam T A 17: 87,636,877 L20Q possibly damaging Het
Ercc4 T C 16: 13,130,686 V589A probably damaging Het
Fcgbp A T 7: 28,093,674 K1034N possibly damaging Het
Fras1 C T 5: 96,657,266 L1256F possibly damaging Het
Gata5 T C 2: 180,333,993 Y126C probably damaging Het
Gja1 T C 10: 56,388,379 L278P probably damaging Het
Gm11596 C A 11: 99,793,021 R91L unknown Het
Gm29125 A T 1: 80,384,437 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hcrtr1 G T 4: 130,137,670 probably null Het
Ifi207 G A 1: 173,729,411 S587L possibly damaging Het
Ino80d T C 1: 63,074,419 T291A probably benign Het
Itgb3 A G 11: 104,633,654 probably null Het
Kif26b A G 1: 178,530,668 S115G unknown Het
Klc3 T C 7: 19,396,349 Y301C probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Meioc A T 11: 102,680,045 R867S probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mthfd2 C A 6: 83,310,483 G200V probably damaging Het
Nrap A G 19: 56,379,109 I312T probably damaging Het
Nrp1 T G 8: 128,434,197 probably null Het
Obscn A G 11: 59,135,408 L323P probably damaging Het
Olfr1499 G A 19: 13,815,569 T7I probably damaging Het
Olfr362 C T 2: 37,105,198 V151M probably benign Het
Olfr738 T C 14: 50,413,573 S10P probably benign Het
Pkn2 A C 3: 142,839,206 probably null Het
Ppp1r18 A G 17: 35,868,345 R371G probably benign Het
Prkar2b A C 12: 31,975,928 V31G probably damaging Het
Reg3b T A 6: 78,371,260 M19K probably damaging Het
Sec14l2 G A 11: 4,118,727 probably benign Het
Sgca C T 11: 94,963,331 R104Q probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Sorcs2 A G 5: 36,039,390 V637A probably damaging Het
Tdrd9 T A 12: 112,036,529 probably null Het
Tmem181a T C 17: 6,295,795 I229T possibly damaging Het
Tmpo A T 10: 91,149,788 probably benign Het
Ttc41 T C 10: 86,719,520 V280A probably benign Het
Vmn1r234 G T 17: 21,229,327 V168F probably benign Het
Wnt16 T A 6: 22,297,849 M238K probably damaging Het
Zfp607b A G 7: 27,703,747 T543A probably benign Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18583819 missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18582964 missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18597265 missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18583959 missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18597567 missense probably benign
IGL02672:Vmn2r96 APN 17 18598114 missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18582589 missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18582875 missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18586372 missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18582565 missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18584000 missense probably benign
R0580:Vmn2r96 UTSW 17 18582638 missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18597568 missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18582476 missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18597726 missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18582653 missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18597921 missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18586402 missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18583876 missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18584001 missense probably benign
R2405:Vmn2r96 UTSW 17 18597840 missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18598077 missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18583008 missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18582826 missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18597508 missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18597604 missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18582656 missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18583858 missense possibly damaging 0.65
R5507:Vmn2r96 UTSW 17 18597829 missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18583959 missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18583864 missense probably benign
R6339:Vmn2r96 UTSW 17 18583862 missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18597531 missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18583855 missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18598090 missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18581854 missense probably benign 0.04
R6851:Vmn2r96 UTSW 17 18582538 missense possibly damaging 0.95
R6944:Vmn2r96 UTSW 17 18597629 missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18597838 missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18598021 missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18583820 missense probably benign
R7149:Vmn2r96 UTSW 17 18597727 missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18582767 missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18583040 missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18573400 missense probably benign 0.02
R7509:Vmn2r96 UTSW 17 18582733 missense not run
Z1088:Vmn2r96 UTSW 17 18597366 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCGAGCTCTGAGTTACATTTTGC -3'
(R):5'- TAACTCCCAAGGGCCATGAAG -3'

Sequencing Primer
(F):5'- GGTAAGCCAACCACAGTTTCCTG -3'
(R):5'- GCCATGAAGCAGAGGTATCCC -3'
Posted On2016-07-22