Incidental Mutation 'R5302:Ttc37'
ID404314
Institutional Source Beutler Lab
Gene Symbol Ttc37
Ensembl Gene ENSMUSG00000033991
Gene Nametetratricopeptide repeat domain 37
Synonyms
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location76098734-76190316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76147767 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1050 (E1050K)
Ref Sequence ENSEMBL: ENSMUSP00000153521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091466
AA Change: E1050K

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: E1050K

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224289
Predicted Effect possibly damaging
Transcript: ENSMUST00000224386
AA Change: E1050K

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Ttc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ttc37 APN 13 76143278 critical splice donor site probably null
IGL00650:Ttc37 APN 13 76127507 missense possibly damaging 0.89
IGL00838:Ttc37 APN 13 76134791 missense probably damaging 0.99
IGL00958:Ttc37 APN 13 76122745 missense probably damaging 0.98
IGL01011:Ttc37 APN 13 76122665 missense probably damaging 0.97
IGL01062:Ttc37 APN 13 76155462 nonsense probably null
IGL01319:Ttc37 APN 13 76129379 missense probably benign 0.29
IGL01697:Ttc37 APN 13 76128733 missense probably benign 0.01
IGL02061:Ttc37 APN 13 76129541 critical splice donor site probably null
IGL02184:Ttc37 APN 13 76111691 missense probably damaging 1.00
IGL02309:Ttc37 APN 13 76127047 missense possibly damaging 0.90
IGL03230:Ttc37 APN 13 76155647 splice site probably benign
IGL03354:Ttc37 APN 13 76182822 missense possibly damaging 0.71
R0501:Ttc37 UTSW 13 76147806 missense probably benign
R0628:Ttc37 UTSW 13 76150729 missense possibly damaging 0.89
R0711:Ttc37 UTSW 13 76182891 missense probably damaging 1.00
R0928:Ttc37 UTSW 13 76113592 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1524:Ttc37 UTSW 13 76138372 missense probably benign 0.01
R1628:Ttc37 UTSW 13 76111791 missense possibly damaging 0.75
R1702:Ttc37 UTSW 13 76122743 missense possibly damaging 0.66
R1750:Ttc37 UTSW 13 76140601 missense possibly damaging 0.89
R1822:Ttc37 UTSW 13 76130288 missense probably benign 0.35
R1885:Ttc37 UTSW 13 76113047 missense probably benign 0.00
R1885:Ttc37 UTSW 13 76130235 missense probably benign 0.11
R1923:Ttc37 UTSW 13 76134770 missense probably damaging 1.00
R1978:Ttc37 UTSW 13 76134815 missense probably benign 0.00
R2040:Ttc37 UTSW 13 76180103 missense probably damaging 1.00
R2136:Ttc37 UTSW 13 76173354 missense possibly damaging 0.87
R2268:Ttc37 UTSW 13 76112274 unclassified probably benign
R2483:Ttc37 UTSW 13 76182867 missense probably damaging 1.00
R2988:Ttc37 UTSW 13 76155689 missense probably benign 0.11
R3701:Ttc37 UTSW 13 76113679 missense probably benign
R3951:Ttc37 UTSW 13 76130219 missense probably damaging 1.00
R4405:Ttc37 UTSW 13 76155665 missense probably damaging 0.97
R4411:Ttc37 UTSW 13 76127504 missense possibly damaging 0.89
R4957:Ttc37 UTSW 13 76185113 unclassified probably null
R4960:Ttc37 UTSW 13 76185156 missense possibly damaging 0.95
R4993:Ttc37 UTSW 13 76182936 missense probably damaging 0.96
R5206:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5208:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5305:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5306:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5579:Ttc37 UTSW 13 76185200 missense probably damaging 1.00
R5618:Ttc37 UTSW 13 76173426 missense probably benign
R5726:Ttc37 UTSW 13 76118347 missense probably damaging 1.00
R5813:Ttc37 UTSW 13 76155733 missense probably benign 0.05
R5899:Ttc37 UTSW 13 76111819 splice site probably null
R6146:Ttc37 UTSW 13 76185240 missense probably damaging 1.00
R6224:Ttc37 UTSW 13 76118291 missense probably benign 0.02
R6286:Ttc37 UTSW 13 76143240 missense probably damaging 1.00
R6402:Ttc37 UTSW 13 76135270 missense probably benign 0.05
R6561:Ttc37 UTSW 13 76150519 missense probably damaging 1.00
R6808:Ttc37 UTSW 13 76185179 missense probably damaging 0.96
R7054:Ttc37 UTSW 13 76134960 missense probably damaging 1.00
X0067:Ttc37 UTSW 13 76132933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGTGCAGTCAGATCCTCTC -3'
(R):5'- TTTTAGTAAACACTGCAACCCC -3'

Sequencing Primer
(F):5'- GCAGTCAGATCCTCTCTATGTGTG -3'
(R):5'- CTAGAGGATCAAGGTTCAATTCCCAG -3'
Posted On2016-07-22